ID: 975801337

View in Genome Browser
Species Human (GRCh38)
Location 4:78061507-78061529
Sequence TCCCACAAACGCTGAATCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 100}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975801334_975801337 -5 Left 975801334 4:78061489-78061511 CCATGTGATTTTAGCCATTCCCA 0: 1
1: 0
2: 1
3: 21
4: 198
Right 975801337 4:78061507-78061529 TCCCACAAACGCTGAATCCCGGG 0: 1
1: 0
2: 0
3: 6
4: 100
975801333_975801337 5 Left 975801333 4:78061479-78061501 CCATCACTCTCCATGTGATTTTA 0: 1
1: 0
2: 2
3: 31
4: 328
Right 975801337 4:78061507-78061529 TCCCACAAACGCTGAATCCCGGG 0: 1
1: 0
2: 0
3: 6
4: 100
975801332_975801337 6 Left 975801332 4:78061478-78061500 CCCATCACTCTCCATGTGATTTT 0: 1
1: 0
2: 0
3: 28
4: 343
Right 975801337 4:78061507-78061529 TCCCACAAACGCTGAATCCCGGG 0: 1
1: 0
2: 0
3: 6
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975801337 Original CRISPR TCCCACAAACGCTGAATCCC GGG Intronic
905975162 1:42168962-42168984 TCACAAAAACCCTGAATGCCAGG - Intergenic
910251562 1:85202575-85202597 TCCCAAAAACGTTAAATTCCAGG + Intergenic
918313163 1:183301198-183301220 TGCCAGAAATGCTGAATCTCAGG - Intronic
920377087 1:205514720-205514742 TTCCACAAATGCTGAGTACCTGG + Intronic
922857012 1:228783947-228783969 TCCATGAAAGGCTGAATCCCTGG - Intergenic
1063207896 10:3852257-3852279 TAACACAAACCCTGAATTCCTGG + Intergenic
1065813050 10:29460015-29460037 TCACACAAACCTTGAACCCCTGG - Intronic
1066511906 10:36109511-36109533 TCCAACAAACTCTGAAACACAGG - Intergenic
1078035961 11:7805817-7805839 TCCCACAAGCCCTGAAGTCCTGG + Intergenic
1081691360 11:45080665-45080687 TGGCACAAACTGTGAATCCCTGG + Intergenic
1084366858 11:68707089-68707111 TGCCACAGACTCTGGATCCCAGG + Intergenic
1084417926 11:69044189-69044211 ACCCACAAACGGTGACTGCCAGG + Intergenic
1087523909 11:99282840-99282862 TTCCACAGATGCTGACTCCCAGG - Intronic
1093340442 12:17967233-17967255 TCCCACAGAGGCTCAGTCCCAGG + Intergenic
1095416432 12:41982262-41982284 TCCCTCAATCCCTCAATCCCTGG + Intergenic
1096414578 12:51402238-51402260 TTCAACAACAGCTGAATCCCAGG - Intronic
1098705622 12:73685255-73685277 TACCCCAAAGGGTGAATCCCAGG + Intergenic
1099515964 12:83597175-83597197 ATCCACAATTGCTGAATCCCAGG + Intergenic
1102406578 12:112679089-112679111 TCCCACAAACTCTGTCTTCCAGG - Intronic
1105941335 13:25150566-25150588 ACCCACAAACACAGAATCCAAGG + Intergenic
1117061685 14:51970501-51970523 ACCCACGAACTCAGAATCCCTGG + Intronic
1119360515 14:74045383-74045405 TACCACAAACTCTGCCTCCCGGG + Intronic
1123476591 15:20595719-20595741 TCCTACAAATTCAGAATCCCGGG + Intergenic
1123641420 15:22404645-22404667 TCCTACAAATTCAGAATCCCGGG - Intergenic
1126617467 15:50599759-50599781 TCCCACCCACCCTGAATCCATGG + Intronic
1129172340 15:73815974-73815996 TCCCACAAAGACTGTTTCCCAGG + Intergenic
1130084564 15:80766398-80766420 TCTCACAAATGCAGAATCTCAGG - Intergenic
1130150623 15:81308847-81308869 TCCCATAACCGCTGATTCTCAGG + Intronic
1131521988 15:93123329-93123351 TCCCAGAAATGCGGAATCTCAGG - Intergenic
1131986187 15:98044563-98044585 TTCCACACCTGCTGAATCCCTGG + Intergenic
1132201867 15:99960524-99960546 TCCAACAAACTCTGATTCACTGG + Intergenic
1133672778 16:8039979-8040001 TACCACAACCTCTGACTCCCAGG - Intergenic
1138466326 16:57193988-57194010 TACCACAAACTCTGTCTCCCGGG - Intronic
1139912082 16:70403735-70403757 TCACACAACCTCTGACTCCCTGG - Intronic
1141723631 16:85771518-85771540 TACCACAAACTCTGCCTCCCAGG - Intergenic
1142265639 16:89062953-89062975 TCCCACAACCCCTGGGTCCCAGG + Intergenic
1143546831 17:7601972-7601994 TCCCACAAAGGCTGACTATCAGG + Intronic
1144421288 17:15101476-15101498 TCCCAAAGCCCCTGAATCCCTGG + Intergenic
1147890076 17:43710963-43710985 TCCCACAAACGCTGCTGCCATGG - Intergenic
1149582547 17:57761446-57761468 TACCACAAACTCTGCTTCCCGGG + Intergenic
1150710704 17:67528774-67528796 TCCTAAAAATGCTGAATCTCAGG - Intronic
1152931228 17:83111168-83111190 TCCCCCAAACCCTGAGTCCAGGG - Intergenic
1153968029 18:10199506-10199528 TGCTACAAACACTGATTCCCAGG + Intergenic
1154111575 18:11572945-11572967 CCCCAGAAACGCAGAATCACAGG + Intergenic
1160510681 18:79451846-79451868 TCCCACCAGCGCCGAAGCCCAGG - Intronic
1161196482 19:2989333-2989355 TCCCAGAAGCCCTGCATCCCTGG - Intronic
1163453171 19:17390957-17390979 TCCCACCGACGCTGGATCCTGGG + Intergenic
1164449008 19:28343383-28343405 TCCCCCAAAGACTGAATTCCTGG - Intergenic
1165284180 19:34825508-34825530 TCCCAGAAAAGCTGCAGCCCTGG + Intergenic
1167828184 19:51994109-51994131 TCCCACATACACTGCATCCATGG + Exonic
1167980924 19:53274274-53274296 TCTCACAAGGTCTGAATCCCGGG - Intergenic
928555033 2:32414589-32414611 CACCACAACCTCTGAATCCCAGG - Intronic
931987944 2:67759048-67759070 TCCGACAAAATCTGAATCCAGGG - Intergenic
933719279 2:85386925-85386947 TCCCACAACCTCTGCCTCCCAGG - Intronic
933754239 2:85625308-85625330 TCCCAAAATCACTGAATCCCAGG - Intronic
935112998 2:100108870-100108892 TCCCAGAAACACTCATTCCCAGG - Intronic
937032957 2:118756084-118756106 TCCTAGAGATGCTGAATCCCAGG + Intergenic
944001425 2:194842960-194842982 GCCCACAACCCCTGAAGCCCCGG - Intergenic
944089537 2:195890433-195890455 TCCCACAAATACTGAGTCTCAGG - Intronic
946778633 2:223170409-223170431 TCCCTCAAACTCTGACTCCCTGG - Intronic
948364754 2:237447642-237447664 TCCCAGAAACGCTGCTTCCCAGG + Intergenic
1174593517 20:51665646-51665668 TACCACAAACTCTGCCTCCCGGG - Intronic
1179163006 21:38913131-38913153 TCACACAAACGCGGAAGCACGGG - Intergenic
1179930580 21:44568555-44568577 TCCCACCAACTTTGAATCCCAGG - Intronic
1180062445 21:45392681-45392703 TCCCAGAAGTGCTGACTCCCCGG + Intergenic
1180612709 22:17108331-17108353 TCCCCCCACCGCTGAAGCCCAGG + Exonic
1185122014 22:48976987-48977009 TCCTACAGATGCTGAAACCCTGG + Intergenic
1185365761 22:50436026-50436048 TCCCAGAAACGCAGAAGCCGTGG - Intronic
949270887 3:2215477-2215499 TCCCACAGATGTTGAATCACTGG + Intronic
950146468 3:10653549-10653571 TCCGCCAAAGGCAGAATCCCTGG + Intronic
957106812 3:75899862-75899884 TCACACAACCACTGACTCCCGGG + Intergenic
961949440 3:130733368-130733390 ACACACAAACGTTGATTCCCAGG + Intronic
974202455 4:58658700-58658722 TCCCAAAAAGGCTGAATCACAGG + Intergenic
975645622 4:76543048-76543070 TCTTCAAAACGCTGAATCCCTGG + Intronic
975801337 4:78061507-78061529 TCCCACAAACGCTGAATCCCGGG + Intronic
984751930 4:183286387-183286409 TCCCACAATCGCTCAAGACCTGG - Intronic
985723731 5:1504636-1504658 CCCCACAACCTCTGACTCCCGGG - Intronic
992512958 5:77458281-77458303 TCCCAAAAAGGCAGAATCTCTGG - Intronic
993362667 5:86997532-86997554 TCCCACACACCCTGAATCCTAGG - Intergenic
995506699 5:112868474-112868496 TACCACAACCTCTGCATCCCAGG + Exonic
998256203 5:140590911-140590933 TGCCACACACGCTGGGTCCCGGG + Intronic
998341269 5:141419893-141419915 TCCCACACCCTCTGACTCCCAGG + Exonic
998530259 5:142877759-142877781 TCCAACTAACTCAGAATCCCTGG - Intronic
1002664305 5:180811058-180811080 TCCCCCTCACGCTGAATCCAGGG + Intronic
1011531810 6:88331210-88331232 TCCCACAACCTCTGCCTCCCAGG - Intergenic
1016030146 6:139328731-139328753 CACCACAACCTCTGAATCCCTGG - Intergenic
1019449326 7:1088669-1088691 TCTCACCAACCCTGAAGCCCTGG + Intronic
1019936345 7:4260701-4260723 TCCCACACACGCAGAGACCCTGG - Intronic
1020985193 7:15124835-15124857 TCCCACAAAGGCTGAAGTCATGG + Intergenic
1022242839 7:28529578-28529600 TCCCTCAAACACAGAATCCAAGG + Intronic
1022247191 7:28571686-28571708 TCTCAGAAACGCAGAATCTCTGG + Intronic
1022297541 7:29069980-29070002 TCCAACAAATCCTGAAACCCAGG - Intronic
1024822522 7:53350026-53350048 TCCCAGAAACCCTGAGTCACAGG - Intergenic
1025752880 7:64308204-64308226 TCCCACACAGGCTGGTTCCCAGG + Intronic
1034413602 7:150953875-150953897 TCCCAGAAGCACTGACTCCCAGG + Intronic
1034622315 7:152464888-152464910 TCCAGCAAACCCTGCATCCCAGG - Intergenic
1035771459 8:2150404-2150426 TCCCACAAAACCTGTAACCCAGG + Intronic
1042886746 8:73560660-73560682 CCCCAAAAAGGCAGAATCCCAGG + Intronic
1052376325 9:27721862-27721884 TTCCAGAAACTCTGAGTCCCAGG - Intergenic
1056170484 9:83980277-83980299 TCGCACCATCGCTGAAGCCCTGG - Intronic
1057643602 9:96852891-96852913 TACCACAAACGAGGGATCCCCGG + Exonic
1059459720 9:114421966-114421988 CCCCAGAAACCCAGAATCCCAGG + Intronic
1061925571 9:133804576-133804598 TCCGTCAAAGGCTGAAGCCCTGG - Intronic
1187684779 X:21805193-21805215 CACCACAAACTCTGCATCCCAGG - Intergenic
1190090036 X:47429479-47429501 TACCACAAACTCTGCCTCCCGGG - Intergenic
1192135081 X:68589437-68589459 TGCCATAAAGGGTGAATCCCAGG + Intergenic
1195081666 X:101377123-101377145 TGCCACACACCCTGACTCCCTGG + Intronic