ID: 975803825

View in Genome Browser
Species Human (GRCh38)
Location 4:78091721-78091743
Sequence GGTCATAGTGCCCTACAGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 4, 3: 28, 4: 225}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975803821_975803825 11 Left 975803821 4:78091687-78091709 CCCAGGCTGGAGTGCTGTGGCTA 0: 18
1: 700
2: 12321
3: 182013
4: 262059
Right 975803825 4:78091721-78091743 GGTCATAGTGCCCTACAGCCCGG 0: 1
1: 0
2: 4
3: 28
4: 225
975803822_975803825 10 Left 975803822 4:78091688-78091710 CCAGGCTGGAGTGCTGTGGCTAT 0: 19
1: 498
2: 1977
3: 19452
4: 202332
Right 975803825 4:78091721-78091743 GGTCATAGTGCCCTACAGCCCGG 0: 1
1: 0
2: 4
3: 28
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975803825 Original CRISPR GGTCATAGTGCCCTACAGCC CGG Intronic
900194605 1:1369513-1369535 TGTGCTAGTGCCCTCCAGCCTGG - Intergenic
900290639 1:1922198-1922220 GGTCATACTACCCTAGAGCCTGG - Exonic
900357068 1:2270122-2270144 GGTCATTGTCCCCTACAGCCAGG + Intronic
902216592 1:14938094-14938116 GGTCATAGAGCCCCACTGCCTGG + Intronic
902349684 1:15845346-15845368 AATCATAGTGCACTACAGCTTGG + Intergenic
903904070 1:26671165-26671187 GGTGAGAGTGCACTCCAGCCTGG - Intergenic
905409653 1:37759715-37759737 GATCATAGTGCATTACAGCCTGG - Intronic
907164212 1:52395933-52395955 GATCACAGTGCACTATAGCCTGG - Intronic
909253618 1:73390124-73390146 GCTCTTAGTGCATTACAGCCTGG + Intergenic
911892299 1:103386881-103386903 GATTATGGTGCCCTACATCCTGG + Intergenic
912403000 1:109411684-109411706 GATCATAGCTCACTACAGCCTGG + Intronic
912466383 1:109877641-109877663 TGTAATAGTGTCCTACAGCCTGG - Intergenic
912769674 1:112452234-112452256 GATCATAGCACCCTATAGCCTGG + Intronic
914502504 1:148259540-148259562 TGTCATAGCTCACTACAGCCTGG - Intergenic
914807855 1:151004685-151004707 GGTGACACTGCACTACAGCCTGG + Intronic
915331387 1:155114889-155114911 GGTCTGAGTGCACTCCAGCCTGG - Intergenic
915414917 1:155734249-155734271 GGTGCTACTGCACTACAGCCTGG - Intronic
916802084 1:168225505-168225527 GGTCATAGCTCATTACAGCCTGG + Intergenic
916993005 1:170265372-170265394 GGACATGGTGCCCTTCATCCTGG - Intergenic
917061857 1:171049726-171049748 GTTCACACTGCCCTCCAGCCTGG - Intronic
917429983 1:174956262-174956284 CGTCATAGTGCACTGCAGCCTGG + Intronic
917849962 1:179053368-179053390 GATCATAGCTCCCTGCAGCCTGG - Intronic
917935202 1:179859869-179859891 GGTACTACTGCCCTCCAGCCTGG - Intronic
919673561 1:200359788-200359810 GATCATAGTACACTACAGCCTGG - Intergenic
919680069 1:200425454-200425476 CATCATAGTGCCCTGCCGCCTGG + Intergenic
920220162 1:204391337-204391359 GGTGCTAATGCCCTCCAGCCTGG + Intergenic
920375045 1:205503797-205503819 GGGCACAGTGCCCCACCGCCAGG - Intergenic
921155536 1:212435412-212435434 AGTCATGGTGCACTAGAGCCTGG + Intronic
921174605 1:212583296-212583318 GCTCATAGTGCACTACACTCTGG + Intronic
922333642 1:224600573-224600595 AATCATAGTGCACTGCAGCCTGG + Intronic
923574385 1:235144679-235144701 AGTCATAGTCCACTATAGCCTGG - Intronic
924183203 1:241460038-241460060 AGTCATAATGCCCTACAGGAGGG + Intergenic
924813296 1:247421931-247421953 GGTCATAGCTCACTCCAGCCTGG - Intronic
1063948062 10:11196602-11196624 GGTTATACTGCACTCCAGCCTGG + Intronic
1064716447 10:18181678-18181700 AGTCATAGTTCACTGCAGCCTGG + Intronic
1064843579 10:19624989-19625011 GATCATAGCTCACTACAGCCTGG - Intronic
1064988784 10:21237648-21237670 GGTGCTACTGCCCTCCAGCCTGG - Intergenic
1067294032 10:44964313-44964335 GGACAGAGTGTCCTCCAGCCTGG + Intronic
1070068360 10:73060505-73060527 GATCATGGTGCACTACAGCCTGG - Intronic
1070365177 10:75729861-75729883 GATCATAGCTCACTACAGCCTGG + Intronic
1073800030 10:107031667-107031689 AATCATAGTGCACTACAGGCTGG + Intronic
1075696684 10:124441260-124441282 GATCATGGCTCCCTACAGCCTGG + Intergenic
1077113927 11:874518-874540 GATCATAGCGCACTGCAGCCTGG + Intronic
1078311241 11:10245343-10245365 GGTCATTGTGCACTATAGTCTGG - Intronic
1080567155 11:33521103-33521125 GATCATAGTTCACTGCAGCCTGG - Intergenic
1083808749 11:65090459-65090481 GATCATAGTTCACTGCAGCCTGG - Intronic
1084091919 11:66884366-66884388 GGTCCCAGTGCACTCCAGCCTGG + Intronic
1084270757 11:68027954-68027976 TGTCATGGTGGTCTACAGCCTGG - Exonic
1084501036 11:69535577-69535599 GATCATAGTTCACTACAGCCTGG + Intergenic
1085656898 11:78323839-78323861 GGTGCCAGTGCCCTCCAGCCTGG - Intronic
1086867875 11:92002012-92002034 GATCATAGTTCACTGCAGCCTGG - Intergenic
1091721685 12:2818595-2818617 GATCATAGCTCACTACAGCCTGG - Intronic
1092684404 12:11026099-11026121 GATCATAGTCCACTGCAGCCTGG + Intronic
1096690493 12:53318070-53318092 GGTGATATTGCACTCCAGCCTGG - Intronic
1097474271 12:60034253-60034275 GGACATGGTGCCCTGCATCCTGG - Intergenic
1098730208 12:74025881-74025903 GGTGACACTGCACTACAGCCTGG + Intergenic
1099174145 12:79401326-79401348 AATCATAGTGCACTGCAGCCTGG - Intronic
1101988751 12:109467576-109467598 GGCCCTAGTGCACTTCAGCCTGG + Intronic
1102265805 12:111483846-111483868 AGTCACAGTTCCCTGCAGCCTGG + Intronic
1103428004 12:120855338-120855360 GGTCATAGTGCTAAATAGCCAGG - Intronic
1103576978 12:121885243-121885265 GGTGCTACTGCACTACAGCCTGG - Intergenic
1106515228 13:30447420-30447442 AGTCATTGTGCACTACATCCTGG + Intergenic
1107915980 13:45151423-45151445 GTTCATAGTGAGCTACAGCCTGG + Intronic
1109751460 13:66698642-66698664 GATCATAGCTCACTACAGCCTGG + Intronic
1111106795 13:83655338-83655360 CGTCCTACTGCCCTCCAGCCTGG + Intergenic
1111323718 13:86664108-86664130 GGACATGGTGCCCTACATCATGG - Intergenic
1113423514 13:110188429-110188451 GGTCATAGTGCCTAGCAGGCTGG - Intronic
1113735088 13:112672709-112672731 TGTCCCAGTGCCCCACAGCCTGG + Intronic
1115213380 14:30990461-30990483 AGTCATAGTGCCCTTTGGCCGGG - Intronic
1115247477 14:31310936-31310958 AATCATAGTGCACTACAGCTGGG - Intronic
1117731799 14:58729979-58730001 GGTGATATTGCACTCCAGCCTGG + Intergenic
1119357827 14:74021543-74021565 GGTGCTACTGCACTACAGCCTGG + Intronic
1120234601 14:81876102-81876124 GGAGATAGTGCCCTGCATCCTGG + Intergenic
1122338518 14:101009159-101009181 GGTCAATGTCCCATACAGCCAGG - Intergenic
1124032914 15:26027658-26027680 GTTCATAGTGCGCTGCAGGCTGG + Intergenic
1124339798 15:28883447-28883469 GATCATAGTTCACTGCAGCCTGG + Intergenic
1124954414 15:34350724-34350746 GGTCATAGTGGGCTTCAGCCGGG - Exonic
1126442756 15:48709272-48709294 GGTCATAGCTCACTGCAGCCTGG + Intergenic
1127395428 15:58540845-58540867 GATCACACTGCCCTCCAGCCTGG - Intronic
1128037379 15:64538898-64538920 GATCATAGTTCACTGCAGCCTGG + Intronic
1132077730 15:98836451-98836473 GATCATAGTTCACTGCAGCCTGG - Intronic
1132123435 15:99197857-99197879 GATCATACTGCACTCCAGCCTGG + Intronic
1132179837 15:99743894-99743916 GATCATAGGTCCCTGCAGCCTGG - Intergenic
1134774260 16:16838236-16838258 GCTCACAGGGCCCCACAGCCTGG - Intergenic
1136024581 16:27461454-27461476 GGTGGAAGTGCCCTCCAGCCTGG - Exonic
1136487598 16:30583277-30583299 GGTCAGAGTGTCCTTGAGCCAGG + Exonic
1137896836 16:52222023-52222045 AATCATAGTGCATTACAGCCTGG - Intergenic
1138090002 16:54166101-54166123 GATCATAGCTCACTACAGCCTGG - Intergenic
1138210190 16:55156900-55156922 GCTCATATTTCCATACAGCCAGG - Intergenic
1140390100 16:74579113-74579135 GATCATAGCTCACTACAGCCTGG - Intronic
1140523722 16:75604387-75604409 TGTCCCAGTGCCCTCCAGCCTGG + Intronic
1141182763 16:81765585-81765607 GGTGCTAGTGCCCTCCAGCCTGG + Intronic
1141892965 16:86939518-86939540 GATCATAGTGCCCTCCACCCTGG - Intergenic
1143367035 17:6415146-6415168 GGTCCTAGTGCCCTCTGGCCAGG - Intronic
1144235442 17:13256386-13256408 GGTCATAGTGCCCTGCAGTGAGG - Intergenic
1145127820 17:20316408-20316430 GGTGCTATTGCCCTCCAGCCTGG - Intronic
1147701639 17:42399779-42399801 GGTCATAGCTCACTGCAGCCTGG + Intergenic
1148374614 17:47131710-47131732 GGTGATACTGCACTCCAGCCTGG - Intronic
1149090496 17:52772399-52772421 GGTCACATTGCACTCCAGCCTGG + Intergenic
1150505983 17:65699691-65699713 GATCATAGCACCCTATAGCCTGG + Intronic
1151617092 17:75220460-75220482 GGTGATTGTGCACTGCAGCCTGG - Intronic
1152056379 17:78031055-78031077 TGCCATACTGCCCTCCAGCCTGG + Intronic
1152858120 17:82677764-82677786 GGTCAGAGGGCCCCACATCCGGG - Intronic
1153264885 18:3260583-3260605 GATCATAATGCACTACAACCTGG - Intergenic
1154195162 18:12260238-12260260 GGCCACAGTGCACTCCAGCCTGG - Intronic
1155468112 18:26161670-26161692 GATCATAGTGCACTACAGCCTGG - Intronic
1156353531 18:36321986-36322008 AGAGATAGTGTCCTACAGCCAGG - Intronic
1157840108 18:50949397-50949419 GGTCATAGAGCACTGCAGCCTGG + Exonic
1158962009 18:62595453-62595475 GATCACAGTTCACTACAGCCTGG + Intergenic
1161833329 19:6626369-6626391 GGTGACAGTGCACTCCAGCCTGG + Intergenic
1162050836 19:8031738-8031760 GATCATAGCTCACTACAGCCTGG - Intronic
1162431166 19:10629641-10629663 GATCATAGCTCGCTACAGCCTGG + Intronic
1163543513 19:17926502-17926524 GGTTATAGAGGCCCACAGCCTGG - Intergenic
1164758597 19:30709667-30709689 GGTACCAGTGCACTACAGCCTGG - Intronic
1165197633 19:34117373-34117395 TGTCATTGTGCACTACAGCCTGG + Intergenic
1165248052 19:34509133-34509155 AGTCATAGCTCCCTGCAGCCTGG - Exonic
1165552618 19:36601484-36601506 GATCATAGCTCACTACAGCCTGG - Intronic
1167218713 19:48183148-48183170 GGTGATAGAGCACTCCAGCCTGG - Intronic
1167476294 19:49703251-49703273 GGTGCCAGTGCACTACAGCCTGG - Intronic
1168664136 19:58190192-58190214 GATCGCACTGCCCTACAGCCTGG - Intronic
925873443 2:8291287-8291309 GGTCATGGAGGCATACAGCCTGG - Intergenic
928310380 2:30204812-30204834 GTGCAAAGTGCCCTACATCCAGG + Intergenic
930232536 2:48857634-48857656 GGTACTAGAGCCCTCCAGCCTGG - Intergenic
932313596 2:70764716-70764738 GATCATAGTTCCCTGTAGCCGGG - Intronic
934718079 2:96554687-96554709 GGGCCCAGTGCCCCACAGCCCGG + Intergenic
935115619 2:100133508-100133530 GATCATAGTGACTTACAGCCTGG + Intronic
935162722 2:100543185-100543207 GGTAATAGTAGCCTACGGCCAGG - Intergenic
936048038 2:109201831-109201853 GGGCATAGTGCCCTCCCTCCAGG + Intronic
936969956 2:118167884-118167906 GGTCATACTCCCCAAGAGCCAGG - Intergenic
937528656 2:122801767-122801789 GGACCTACAGCCCTACAGCCAGG + Intergenic
937564109 2:123262574-123262596 GGTGCTACTGCACTACAGCCTGG + Intergenic
938237661 2:129719642-129719664 GGTGATATTGCACTCCAGCCTGG + Intergenic
939577690 2:143915764-143915786 GATTATAGTGCACTACTGCCTGG + Intergenic
941042141 2:160634616-160634638 GGTCACAGTGCTCTTTAGCCTGG + Intergenic
941060030 2:160836609-160836631 GGGCATTGTTCCCTTCAGCCTGG + Intergenic
942125655 2:172822606-172822628 GGTTATAGTACCCTACCGGCAGG - Intronic
944311383 2:198237414-198237436 GATCATAGTGCACCACAGCCTGG + Intronic
944479783 2:200144709-200144731 GAACATGGTGCCCTACATCCTGG - Intergenic
946333126 2:219021609-219021631 GATCATAGTGCACTGCAGCGTGG + Intronic
946642899 2:221803225-221803247 GATCATAGCTCACTACAGCCTGG - Intergenic
947856436 2:233327587-233327609 GGTCACATTGCACTCCAGCCTGG - Intronic
1172084027 20:32364599-32364621 GATCATAGTGCACTAGAGCCTGG + Intronic
1173318168 20:41963430-41963452 GGGCATAGTTCACTGCAGCCTGG - Intergenic
1177894226 21:26842362-26842384 TGTCATAGTGCTCTGCATCCCGG + Exonic
1178356941 21:31917256-31917278 GATCATAGGTCACTACAGCCTGG + Intronic
1180757558 22:18173146-18173168 GCTCATACTGCCCTCCAGACTGG - Exonic
1181074218 22:20364299-20364321 GCTCATACTGCCCTCCAGACTGG + Exonic
1183432002 22:37771575-37771597 GCCCATAGTGCCCTGCAGCCCGG - Intronic
1184147723 22:42621282-42621304 GATCATAATGCCCTCCAGCCTGG + Intronic
1185285768 22:49999454-49999476 CGTCTTCCTGCCCTACAGCCAGG - Exonic
950295454 3:11825855-11825877 GATCATAGTTCACTGCAGCCTGG + Intronic
950390574 3:12693453-12693475 GGTGCTACTGCACTACAGCCTGG + Intergenic
950536582 3:13582416-13582438 GGTCCTAGAGGCCCACAGCCTGG - Intronic
954738089 3:52723301-52723323 GGTTCTACTGCCCTTCAGCCTGG - Intronic
955291280 3:57694341-57694363 GATCATAGCGCGCTGCAGCCTGG - Intergenic
955742925 3:62111513-62111535 GGTCATAGCTCACTGCAGCCTGG + Intronic
957040584 3:75332730-75332752 GTTCATAGTGGCCTCCTGCCTGG + Intergenic
957248138 3:77738474-77738496 GATCATAGTTCACTGCAGCCTGG + Intergenic
961008583 3:123421511-123421533 GGTCATAGTGGACCACACCCAGG - Intronic
961045369 3:123704291-123704313 GTTCATAGTGGCCTCCTGCCTGG + Intronic
962189075 3:133291322-133291344 GGTGCTACTGCCCTCCAGCCTGG - Intronic
963905237 3:150768188-150768210 AATCATAGTGCATTACAGCCTGG + Intergenic
964225094 3:154389375-154389397 GGTCATGGTGCCATACAACTGGG + Intronic
966092115 3:176152168-176152190 GGTGCTACTGCCCTCCAGCCTGG + Intergenic
966835300 3:184045060-184045082 GATCACACTGCCCTCCAGCCTGG - Intergenic
967164116 3:186765453-186765475 GGTGACAGTGCACTCCAGCCTGG + Intergenic
967809075 3:193740642-193740664 TGGCATAGTGCACTACAGCCCGG + Intergenic
968336314 3:197916620-197916642 GGTGACACTGCACTACAGCCTGG - Intronic
968530482 4:1088738-1088760 GGACATGGTGCCCTGCATCCTGG + Intronic
968651744 4:1762934-1762956 GGTCCTAGTGACCCACAGCTCGG - Intergenic
968796079 4:2705653-2705675 GGTCATAGCTCACTGCAGCCTGG + Intronic
972920489 4:43934486-43934508 GATCATAGCTCACTACAGCCTGG - Intergenic
975803825 4:78091721-78091743 GGTCATAGTGCCCTACAGCCCGG + Intronic
977202733 4:94136081-94136103 CATCATAGTGCACTACAGCCTGG - Intergenic
979235143 4:118391431-118391453 AGTCATAGCTCACTACAGCCTGG - Intergenic
979559633 4:122087712-122087734 CGGCATAGTGTACTACAGCCCGG + Intergenic
982221422 4:153128633-153128655 GATCACAGTGCCCTGCAGCCTGG - Intergenic
982259558 4:153482655-153482677 TGTCATAGTGAACTGCAGCCTGG + Intronic
982398544 4:154940311-154940333 GGTCACAGTGGAATACAGCCTGG - Intergenic
982843345 4:160220119-160220141 GGACATAGCTCCCTACATCCTGG - Intergenic
983841931 4:172467957-172467979 GATCATAGCTCACTACAGCCTGG + Intronic
986202558 5:5591245-5591267 GGTCTTATTTCTCTACAGCCTGG + Intergenic
987139715 5:14932520-14932542 GGTCATAGCACACTGCAGCCTGG - Intergenic
988497443 5:31757218-31757240 GGTCATAGCTCACTGCAGCCTGG - Intronic
989712425 5:44415568-44415590 AGTCATTGTGCACTATAGCCTGG + Intergenic
991205597 5:64046476-64046498 GGTTGCAGTGCACTACAGCCTGG + Intergenic
992701023 5:79342113-79342135 GATCATAGTTCACTGCAGCCTGG - Intergenic
994252468 5:97552377-97552399 GATCCTGGTGCACTACAGCCTGG - Intergenic
997367128 5:133333200-133333222 GGTCATAGTGCCCAGGAGCAGGG + Intronic
997864590 5:137449818-137449840 GATCATAGCTCACTACAGCCTGG - Intronic
999657408 5:153824389-153824411 AATCATATTGCACTACAGCCTGG - Intergenic
1002095855 5:176830285-176830307 GCTCACAGTGCGCTAAAGCCTGG + Intronic
1003554313 6:7126329-7126351 GGTTGTAGTGCACTCCAGCCTGG - Intronic
1003677106 6:8215520-8215542 GATCATAGCTCCCTGCAGCCTGG + Intergenic
1004411637 6:15386532-15386554 GGTTATAACGCCCTCCAGCCTGG - Intronic
1005045829 6:21641401-21641423 GGTGATACTGCACTCCAGCCTGG - Intergenic
1006824390 6:36923705-36923727 GGTCATAGTGTCCAAAGGCCCGG - Intronic
1010933433 6:81831833-81831855 GGTGTTACTGCCCTTCAGCCTGG - Intergenic
1011418483 6:87147794-87147816 GATCATAGCTCACTACAGCCTGG - Intergenic
1013020900 6:106216809-106216831 GATCATAGTGCAGTACAGCCTGG - Intronic
1013509797 6:110834271-110834293 GATCATAGTTCACTGCAGCCTGG - Intronic
1014523180 6:122470142-122470164 GGTCGTAGTGAACTGCAGCCTGG - Intronic
1015370149 6:132441219-132441241 GGTCATAGCGGCCTACAGGCAGG - Intergenic
1018150399 6:160931779-160931801 GATCAAAGTGCCCTACACCAAGG - Intergenic
1018151820 6:160946824-160946846 GGTCCTACTGCACTCCAGCCTGG - Intergenic
1019758506 7:2790906-2790928 GGTCATAGCTCACTGCAGCCTGG - Intronic
1020696765 7:11422694-11422716 GGTGCTACTGCCCTCCAGCCTGG - Intronic
1021699580 7:23304563-23304585 GGTCATAGCTCACTGCAGCCTGG + Intronic
1026088898 7:67283927-67283949 GGTCATAGTGTATTTCAGCCGGG + Intergenic
1026600835 7:71776016-71776038 GATCATAGCTCACTACAGCCTGG + Intergenic
1026725356 7:72866420-72866442 GGTCATAGTGTATTTCAGCCGGG - Intergenic
1027025216 7:74847034-74847056 GATCATAGCTCCCTGCAGCCTGG + Intronic
1027062547 7:75097085-75097107 GATCATAGCTCCCTGCAGCCTGG - Intronic
1028328115 7:89551923-89551945 GGTCATAGCGCACTGCAGCATGG - Intergenic
1028962386 7:96763310-96763332 GATCACAGAGCACTACAGCCTGG + Intergenic
1029199330 7:98828095-98828117 GATCATAGCTCACTACAGCCTGG + Intergenic
1029477377 7:100792913-100792935 GGTCATGGTTCACTGCAGCCTGG - Intronic
1030925314 7:115445387-115445409 GGGCATACTGCCCTACAGAATGG + Intergenic
1033670554 7:143488791-143488813 GGTCATAGTGGCCTCCAGTGTGG - Intergenic
1036080661 8:5552125-5552147 GATCGTAGTGCACTACAGCCTGG + Intergenic
1036409311 8:8484084-8484106 GATCATAGTGCACTACAGCCTGG - Intergenic
1036556910 8:9868217-9868239 GATCATAGCTCACTACAGCCTGG + Intergenic
1037718520 8:21421029-21421051 GGTACTATTGCCCTCCAGCCTGG - Intergenic
1037968694 8:23155310-23155332 GATCATAGTCTACTACAGCCTGG + Intronic
1039937055 8:42053843-42053865 GATCATAGTTCACTGCAGCCTGG - Intergenic
1040542126 8:48369031-48369053 GGTGCCAGTGCCCTCCAGCCTGG + Intergenic
1042825126 8:72972227-72972249 GGTGATACTGCACTCCAGCCTGG + Intergenic
1044481863 8:92699819-92699841 GGCCAGAGTGGCCCACAGCCGGG - Intergenic
1045653663 8:104365864-104365886 GGTCAGGGTGCCCCTCAGCCAGG - Intronic
1045750066 8:105472959-105472981 GATCATAGCTCACTACAGCCTGG + Intronic
1045917197 8:107486280-107486302 GGTCATAGAGCCAGACTGCCTGG + Intronic
1047452673 8:124979824-124979846 GGTGCTAGTGCACTACAGTCTGG - Intergenic
1047961140 8:130012712-130012734 GGTTTTGGGGCCCTACAGCCTGG - Intronic
1048578264 8:135709811-135709833 GGCCACACTGCCCTGCAGCCGGG - Intergenic
1049918927 9:345446-345468 GGTAATAGTTCCCTCCACCCAGG - Intronic
1051294071 9:15576247-15576269 GATCATTGCTCCCTACAGCCTGG + Intronic
1052485984 9:29100548-29100570 TGTGACACTGCCCTACAGCCTGG + Intergenic
1052955891 9:34253057-34253079 GGCCGCAGTGCCCTGCAGCCGGG + Exonic
1052958174 9:34271027-34271049 GATCATAGTTTACTACAGCCTGG - Intronic
1056335734 9:85566781-85566803 TGACAAAGTGCCCTACAGGCAGG + Intronic
1056519499 9:87387101-87387123 GATCATAGTACACTACAGCCTGG - Intergenic
1056628273 9:88272115-88272137 GGTGCTGGTGCACTACAGCCTGG + Intergenic
1057090905 9:92257424-92257446 GGTCAAAGCTCCCCACAGCCAGG - Intronic
1058278785 9:103084776-103084798 GATCATAGCTCTCTACAGCCTGG + Intergenic
1058905601 9:109480215-109480237 GGTGCTACTGCCCTCCAGCCTGG - Intronic
1059266803 9:113040994-113041016 GGTTACAGTGCACTCCAGCCTGG - Intronic
1060614611 9:125000534-125000556 GATCATAGTTCACTGCAGCCTGG - Intronic
1061037003 9:128119458-128119480 GCGCATAGTGCCCTGCCGCCTGG - Intergenic
1186473846 X:9841991-9842013 CATCATAGTTCACTACAGCCTGG - Intronic
1186845378 X:13525510-13525532 GACCATAGTTCCCTACAGACGGG - Intergenic
1189405822 X:40721613-40721635 GATCATAGAGCCCTAGGGCCTGG + Intronic
1190318812 X:49167316-49167338 GGGAACAGAGCCCTACAGCCAGG + Intronic
1193138548 X:78000706-78000728 GGTCCTACTGCACTCCAGCCTGG - Intronic
1195256997 X:103100840-103100862 GGTGATAGTACGCTACAGCCTGG - Intergenic
1196338717 X:114570073-114570095 AATCACAGTGCACTACAGCCTGG - Intergenic
1196749510 X:119102442-119102464 GATCATAGTGCACTACAGCCTGG + Intronic
1197230525 X:123999053-123999075 GGTGACAGTGCTCTCCAGCCTGG + Intronic
1199623012 X:149715749-149715771 GGTGATGGGGCCCCACAGCCTGG - Exonic