ID: 975804628

View in Genome Browser
Species Human (GRCh38)
Location 4:78099121-78099143
Sequence CCTAGGTCTCAGCTTTAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 95}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975804626_975804628 -8 Left 975804626 4:78099106-78099128 CCTGGTATTGCAAAGCCTAGGTC 0: 1
1: 0
2: 0
3: 5
4: 70
Right 975804628 4:78099121-78099143 CCTAGGTCTCAGCTTTAGAGAGG 0: 1
1: 0
2: 0
3: 10
4: 95
975804623_975804628 -6 Left 975804623 4:78099104-78099126 CCCCTGGTATTGCAAAGCCTAGG 0: 1
1: 0
2: 0
3: 7
4: 92
Right 975804628 4:78099121-78099143 CCTAGGTCTCAGCTTTAGAGAGG 0: 1
1: 0
2: 0
3: 10
4: 95
975804625_975804628 -7 Left 975804625 4:78099105-78099127 CCCTGGTATTGCAAAGCCTAGGT 0: 1
1: 0
2: 1
3: 15
4: 101
Right 975804628 4:78099121-78099143 CCTAGGTCTCAGCTTTAGAGAGG 0: 1
1: 0
2: 0
3: 10
4: 95
975804619_975804628 20 Left 975804619 4:78099078-78099100 CCTCATTGCTTTAGTTTATAAGG 0: 1
1: 0
2: 3
3: 18
4: 505
Right 975804628 4:78099121-78099143 CCTAGGTCTCAGCTTTAGAGAGG 0: 1
1: 0
2: 0
3: 10
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975804628 Original CRISPR CCTAGGTCTCAGCTTTAGAG AGG Intronic
900298275 1:1963878-1963900 CCGAGGTAGCAGCTTCAGAGCGG + Intronic
901863196 1:12087815-12087837 CCTAAGTCACAGCTTTTAAGTGG - Intronic
902142419 1:14367694-14367716 TCTAGGGCTCAGCTTTTGATTGG - Intergenic
904889151 1:33764878-33764900 ACTAGGTTTCAGCCATAGAGGGG + Intronic
906573466 1:46865203-46865225 CCCAACTCTCAGCTTTAGACAGG + Intergenic
907762848 1:57378339-57378361 CCTGGCTCTCATCTTTAGACAGG - Intronic
908823736 1:68114199-68114221 CCAAGGTCTCAGCTTGGGATAGG + Intronic
909496502 1:76285000-76285022 GCCAGCTCTCAGCTTAAGAGAGG + Intronic
910886804 1:91972315-91972337 CTTAGTTGTCAGCTTTAGAGAGG + Intronic
915320432 1:155053124-155053146 CCTCTGACTCAGCTTTAGAATGG - Intronic
919111401 1:193223598-193223620 CCTGAGTCTCAGCTTTATAAGGG + Intronic
919793313 1:201306159-201306181 CCTATTTCTCAGGTGTAGAGGGG + Intronic
1063690649 10:8284020-8284042 CCTAAGTCTCAGCTGTTGTGGGG - Intergenic
1066116676 10:32246858-32246880 CCTATGTGTCAGCTTTAAATTGG - Intergenic
1066629419 10:37444484-37444506 CCCAAGTCTCAGGTTCAGAGTGG + Intergenic
1075025263 10:118979333-118979355 CCAAGGTCTCAGCTGTTTAGCGG - Intergenic
1077679779 11:4227932-4227954 CCAAGTTCTCATTTTTAGAGAGG + Intergenic
1077681706 11:4247976-4247998 CCAAGTTCTCATTTTTAGAGAGG - Intergenic
1078963811 11:16313060-16313082 CATAAGTCTCAGTTTCAGAGGGG + Intronic
1088752595 11:112857019-112857041 CCCAGGACTGAACTTTAGAGAGG + Intergenic
1089854243 11:121528166-121528188 CCTATATCTCAGTTTTAAAGGGG - Intronic
1094002456 12:25709616-25709638 CCGAGGTCTCAGCTAAGGAGAGG + Intergenic
1095351352 12:41217297-41217319 CACAGGGCTCAGGTTTAGAGGGG + Intronic
1099433578 12:82618107-82618129 CACTGGTCTCAGCTTTAGGGTGG - Intergenic
1099513465 12:83566962-83566984 CCAAGGTCTTAGGTTAAGAGAGG + Intergenic
1101825788 12:108218987-108219009 CCTAGGTGCCAGCTGTTGAGGGG + Intronic
1102481789 12:113228832-113228854 GCTCAGTTTCAGCTTTAGAGAGG + Intronic
1105544392 13:21341018-21341040 CCTATGTCCCAGCCCTAGAGGGG + Intergenic
1115492731 14:33973762-33973784 CCTAGATCTCAACTGTTGAGAGG - Intronic
1116172521 14:41421348-41421370 CCTTGTTCTCAGTTTTAGGGAGG - Intergenic
1117338168 14:54772496-54772518 CTTAGGACTCAGCTGTATAGGGG - Intronic
1119175217 14:72563588-72563610 CCTAGGTGACCGGTTTAGAGGGG - Intronic
1120514031 14:85449122-85449144 CCTATGCCTCAGCTGCAGAGGGG - Intergenic
1121550532 14:94796196-94796218 CCTAGGTCTCAACTGGAGAGCGG + Intergenic
1124878518 15:33619781-33619803 CCTGGGTCTCAACTCTAGAGGGG - Intronic
1127631846 15:60834786-60834808 CCTAGGTCTCAGCATTGTCGAGG - Intronic
1127679500 15:61279508-61279530 CCAAGTTCTCAGCTTTTGAAGGG - Intergenic
1129078112 15:73014925-73014947 CCATGGACTCAGCTTTGGAGAGG + Intergenic
1131493133 15:92880386-92880408 CCTAGGATTCAGCTTTGGAGTGG - Intergenic
1134750946 16:16624608-16624630 CCTTGGTCCCTGCTTTAAAGTGG - Intergenic
1134994508 16:18728983-18729005 CCTTGGTCCCTGCTTTAAAGTGG + Intergenic
1138293367 16:55867023-55867045 CCTAGAGGTCAGCTTTTGAGGGG - Intronic
1146910718 17:36646772-36646794 CCTGGGTCACATCTTTAGGGAGG + Intergenic
1148250223 17:46071894-46071916 CCTAGGGCCCTGCTTTGGAGAGG - Intronic
1152572674 17:81127460-81127482 CCTGGGTCTTGGCTTTAGGGAGG + Intronic
1152737738 17:82005565-82005587 CCTGGGTCTCAGCCTTGGTGGGG - Intronic
1154147032 18:11874984-11875006 CCTAGATCTCAGATTTCGTGGGG + Intronic
1154405783 18:14089981-14090003 CCCAGGCCTCAGCTCTACAGAGG - Intronic
1155647680 18:28099838-28099860 GGTAGGTATCACCTTTAGAGTGG + Intronic
1158693380 18:59681688-59681710 CCCAGGTCTATGCTTTAAAGTGG - Intronic
925776378 2:7339976-7339998 CGTAGGCCTCAGCTTTGGGGAGG + Intergenic
927030865 2:19119344-19119366 GCTGGGTCCCAGTTTTAGAGAGG - Intergenic
929950394 2:46405640-46405662 CCTTGGTCTCAGCATCAGATGGG - Intergenic
929975977 2:46635192-46635214 CTAATGTCTCTGCTTTAGAGAGG - Intergenic
931644183 2:64406509-64406531 CCCAGCTCTCAGCTCTACAGAGG - Intergenic
935223268 2:101033026-101033048 CCTACGTCTGAGCTCAAGAGGGG + Intronic
938639511 2:133265451-133265473 CCTAGGACTCAGCAGCAGAGAGG + Intronic
938790545 2:134671810-134671832 CCTAAGTCACAGCTAGAGAGGGG - Intronic
938971719 2:136438940-136438962 TCTTGGTCTGAGCTTTAGAGAGG - Intergenic
941829744 2:169941912-169941934 CAAGGGTCTCAGCTTTAGATGGG + Intronic
942436385 2:175981863-175981885 ATTATGTCTCAGCTTTTGAGGGG - Intronic
1170412573 20:16107161-16107183 CCTAGGTGGCAGCTTTGCAGGGG - Intergenic
1170607346 20:17883912-17883934 CCTAGGGCTCAGCCTTCCAGGGG - Intergenic
1180128186 21:45805989-45806011 GCTGTGTCTCAGCATTAGAGAGG + Intronic
1183494811 22:38137031-38137053 CTTGGCCCTCAGCTTTAGAGGGG + Intronic
950870289 3:16222517-16222539 CCTAGACCTCAGCTCTATAGTGG + Intronic
953211082 3:40875800-40875822 CCTGAGTCTCAGCTTTACTGAGG - Intergenic
953387567 3:42515179-42515201 CATAACTGTCAGCTTTAGAGAGG - Intronic
972729206 4:41776746-41776768 CCTAGGACTCAGCATTGGAGAGG - Intergenic
973539465 4:51921795-51921817 CATGGGTCTAAGCTTAAGAGTGG - Intergenic
975804628 4:78099121-78099143 CCTAGGTCTCAGCTTTAGAGAGG + Intronic
977766859 4:100808902-100808924 GCTATGGCTCAGCTTTAGAAAGG + Intronic
983467771 4:168116187-168116209 ACTAGGTCTCAAATTTTGAGTGG + Intronic
984141136 4:176004974-176004996 CCTAGATCTCAGGTATAGAGAGG + Intergenic
991041887 5:62184833-62184855 CCTTTGTCTCAACTTCAGAGTGG - Intergenic
995314333 5:110750866-110750888 CCTTCATCTCTGCTTTAGAGAGG - Intronic
996835243 5:127784486-127784508 TCTTGGTCTCAGCTTTAAAAAGG + Intergenic
998387320 5:141765000-141765022 GCTATTTCTCAGCTTAAGAGAGG + Intergenic
999014434 5:148084535-148084557 ACTAGGTCACAGGTGTAGAGAGG - Intronic
1001808810 5:174611220-174611242 CCTTGGTCTCAGCTGAAGAAGGG - Intergenic
1019390894 7:786646-786668 CATAGGACTCACCTTGAGAGGGG + Intergenic
1019946075 7:4330504-4330526 CACAGGTCTCGGCTTTTGAGGGG - Intergenic
1020006330 7:4785366-4785388 GCTCTGTCTCAGCCTTAGAGTGG - Intronic
1026265393 7:68791866-68791888 CCTAGGGCTCTGCTTTGAAGAGG + Intergenic
1028770410 7:94614143-94614165 CATAGTTCTCATCATTAGAGAGG + Intronic
1031606643 7:123776134-123776156 CAAAGATCTCAGCTTTAAAGAGG + Intergenic
1031893640 7:127323717-127323739 GCTCCGTCTCAGCTGTAGAGGGG + Intergenic
1031971839 7:128070251-128070273 CCTAGGTCTCAGCTTCAGCATGG + Intronic
1033715050 7:143992127-143992149 CCCAAGTCTCAGGTTTATAGGGG + Intergenic
1034938639 7:155215897-155215919 CCAAGGTCCCGGCTTTACAGGGG - Intergenic
1036772795 8:11590645-11590667 AATAGTCCTCAGCTTTAGAGAGG + Intergenic
1037043910 8:14273239-14273261 CCTAGGACTAAGCTATAAAGAGG - Intronic
1040399086 8:47030071-47030093 CCTATGGCTAAGCTTTAGGGTGG - Intergenic
1041866397 8:62579534-62579556 TGTAGGTCTCAGCATTAGAGAGG + Exonic
1042725267 8:71868437-71868459 ATTAGGCCTCAGCTTTAGATGGG - Intronic
1046068764 8:109225218-109225240 CCAATGTCTCAGCTGTGGAGTGG - Intergenic
1047759616 8:127944658-127944680 CCTCGGTATCAGCTGCAGAGGGG - Intergenic
1049438799 8:142599821-142599843 CGTGGGTCTCAGCTCTAGAGAGG + Intergenic
1049726884 8:144150945-144150967 CCTGGGTCTCAGGTTTATATAGG - Intronic
1050494751 9:6229247-6229269 CCTAGGTCTAAGCTTGGGAAGGG + Intronic
1053471237 9:38347234-38347256 CCTAGGTCTCCCCTTAAAAGAGG - Intergenic
1055430939 9:76243064-76243086 CCTTGGTCTCATCTTTAGCTGGG - Intronic
1057799166 9:98179483-98179505 GTGGGGTCTCAGCTTTAGAGAGG - Intronic
1057872887 9:98731577-98731599 CCTGTGTCTCAGCCTTGGAGAGG + Intronic
1189436816 X:41000299-41000321 CCTAGGTATCTACTTAAGAGAGG - Intergenic
1200375414 X:155774793-155774815 CATAGGCCTCATCTTTGGAGAGG + Exonic