ID: 975809698

View in Genome Browser
Species Human (GRCh38)
Location 4:78154386-78154408
Sequence GGTTTTAAACAAATAGACCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 226}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975809698_975809701 0 Left 975809698 4:78154386-78154408 CCTTGGTCTATTTGTTTAAAACC 0: 1
1: 0
2: 1
3: 16
4: 226
Right 975809701 4:78154409-78154431 CATTTAAAATATTTTTACCATGG 0: 1
1: 0
2: 6
3: 92
4: 932
975809698_975809703 18 Left 975809698 4:78154386-78154408 CCTTGGTCTATTTGTTTAAAACC 0: 1
1: 0
2: 1
3: 16
4: 226
Right 975809703 4:78154427-78154449 CATGGAATTTTGTTCTTAAAAGG 0: 1
1: 0
2: 5
3: 40
4: 376

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975809698 Original CRISPR GGTTTTAAACAAATAGACCA AGG (reversed) Intronic
904308728 1:29611235-29611257 GGTTTTGAACCAAGAGCCCAAGG - Intergenic
905189973 1:36226069-36226091 GGTATTAAATAAATACACTAAGG - Intronic
906015581 1:42576018-42576040 AGTTTTAAAGAGATAGACAAGGG + Intronic
906838536 1:49110431-49110453 GGTTTTCAATAAATAGAAGAAGG - Intronic
908704190 1:66932560-66932582 GGTTTTAAACAATTAGACAAAGG + Intronic
908933889 1:69350930-69350952 GATTTTAATCAAATGCACCAAGG + Intergenic
909888521 1:80973284-80973306 GAATTTAAACAACTAGCCCAAGG + Intergenic
910061600 1:83099903-83099925 CTTTTTCAACAAATAGACCTTGG - Intergenic
910385329 1:86676253-86676275 TGTTTTAAACCACTAAACCATGG + Intergenic
915254017 1:154611772-154611794 GGTTTTTAATAAGTAGACCTAGG - Intronic
918565701 1:185928846-185928868 GTTCTTAAACAATTAGCCCAAGG - Intronic
919052600 1:192529742-192529764 GGTTTTAATGACATAGACAAGGG + Intergenic
919634928 1:199994447-199994469 GGTTTGAAACCAATAGACTGTGG + Intergenic
919817927 1:201453368-201453390 GGATATAAACAAGTAAACCAAGG + Intergenic
1065451287 10:25860693-25860715 TGTTTTAAACAAATAGTGCTGGG + Intergenic
1068148608 10:53102642-53102664 GGTCAAGAACAAATAGACCACGG - Intergenic
1068300996 10:55138876-55138898 GGGTTTAAAAAAATATACAAAGG - Intronic
1068509853 10:57951568-57951590 GGTCTCAAATAAATAGACCTTGG - Intergenic
1068585178 10:58790519-58790541 GGTTTTAAACAAATATGGGAAGG - Intronic
1068754289 10:60633640-60633662 GATTTTAAAAAAATAGAGCTGGG + Intronic
1069377567 10:67809279-67809301 GGTTTTACCCAAAGAGACCCAGG - Intronic
1071065221 10:81624835-81624857 AGGTTTAAACAAATATTCCAAGG - Intergenic
1071482291 10:86073906-86073928 GGTTTTAAACAAATGCACCCAGG + Intronic
1073795151 10:106979200-106979222 GGTTTTAAACAAAGAGAACTGGG + Intronic
1075512160 10:123081338-123081360 TATTTTAAATAAATAGGCCAAGG + Intergenic
1078455766 11:11473762-11473784 GACTTTAATAAAATAGACCAAGG + Intronic
1079932575 11:26583597-26583619 GGTGTTAACCAAAAAGACCGAGG + Intronic
1080256248 11:30294084-30294106 TGTTTTAAACAAATATCTCAAGG + Intergenic
1081295344 11:41379858-41379880 GGTTTTAGACAGAAAGACTAAGG - Intronic
1082960720 11:58916463-58916485 GATGTTAAACAAGTAGCCCAAGG + Intronic
1082980671 11:59117558-59117580 GATGTTAAACAAGTAGCCCAAGG + Intronic
1083111109 11:60408159-60408181 GATTTTCAACAAAAATACCAAGG - Intronic
1087480054 11:98688133-98688155 GGTTTGACTCAAATAGATCAAGG - Intergenic
1087533358 11:99411761-99411783 ATTTTTAAACAAATAGTGCATGG - Intronic
1089186258 11:116617227-116617249 GATTTTAAACAAATCTAACATGG + Intergenic
1089213913 11:116823949-116823971 GGCTTTGAATAACTAGACCAAGG - Intergenic
1089942442 11:122432757-122432779 GGTTTTTAAGAAATAGAGCTTGG - Intergenic
1090401671 11:126453222-126453244 GGTTGTCCTCAAATAGACCAAGG + Intronic
1092130840 12:6112025-6112047 CATTTTAAACAAACAGCCCAGGG - Intronic
1092658488 12:10713469-10713491 GGTTTTAAACAAAGTGAGCAAGG + Intronic
1093562479 12:20558775-20558797 GGCTTTAGACATATTGACCAAGG - Intronic
1095279322 12:40331883-40331905 GGAATTAAACCAATATACCAAGG - Intronic
1095314017 12:40736809-40736831 GGTCTTAAACAAACAAACAAAGG + Intronic
1096456667 12:51793047-51793069 GATTTAAAACAAATGGATCATGG - Intronic
1098332725 12:69371744-69371766 GGTATTAAATAAACAGAACAAGG + Intronic
1098873356 12:75841332-75841354 GGTTTAAAACAACTTGCCCAGGG + Intergenic
1098955722 12:76687643-76687665 GGTGTTAAACATAAAGAGCAGGG + Intergenic
1099219577 12:79897170-79897192 GGTATTAAACATACACACCATGG + Intronic
1101280264 12:103246792-103246814 GCTTTTAAAAACATAGTCCATGG - Intronic
1104985936 12:132597352-132597374 GTTTTTCACCAAATAGAACAAGG - Intergenic
1105731193 13:23218745-23218767 GTATTAATACAAATAGACCAAGG + Intronic
1107630653 13:42339381-42339403 GTATTTAAACAAATAGATCCTGG + Intergenic
1107764808 13:43722847-43722869 AGTCTTTAACAAATAGACCTGGG - Intronic
1108213514 13:48161368-48161390 GGTTTGAAAAAACAAGACCAAGG + Intergenic
1109425351 13:62159953-62159975 GGTTTTAAACACATAGGTCTAGG - Intergenic
1110031723 13:70623831-70623853 GTTTTTAAACAAATAAAAGAGGG - Intergenic
1110862334 13:80356948-80356970 TGTTGTAAACACATTGACCACGG - Intergenic
1111298693 13:86318135-86318157 GCTTTTTAAAAAATTGACCAGGG + Intergenic
1112858745 13:103804138-103804160 GATCTTAAAGAAATAGACTATGG + Intergenic
1112970064 13:105250548-105250570 GGTTTTAAAAAAATAGTTCTAGG - Intergenic
1115019936 14:28666287-28666309 GGTTTTAAAAAAATAAACAGAGG - Intergenic
1115176788 14:30571696-30571718 GCTTTTCAACAAAGATACCAAGG - Intronic
1116347612 14:43815201-43815223 GGTGTTAAAAAAATGGACAATGG - Intergenic
1117944833 14:61007808-61007830 GGTTTAAAATATATATACCAAGG + Intronic
1118160262 14:63281612-63281634 GGTTTAAAAGGAATAGACAATGG - Intronic
1118350401 14:64969671-64969693 GGTTTTAGGCCAATATACCAAGG + Intronic
1118433506 14:65747222-65747244 GGTTATAAACTAATGGGCCATGG - Intergenic
1118730124 14:68660029-68660051 GCTTTTAAACGAATAAGCCATGG + Intronic
1119571240 14:75675333-75675355 GGGTTTAAACAAAAATAGCATGG - Intronic
1120200424 14:81533179-81533201 GTTTTTAAACAGACAGACCAGGG + Intronic
1121034491 14:90689129-90689151 GATTTTAAACAAAAGGATCAAGG + Intronic
1121347922 14:93149772-93149794 GGTTTTGAAGAAATAGCACAGGG + Intergenic
1124082157 15:26509996-26510018 GCTTTTCAACAAAGAGGCCAAGG + Intergenic
1124469664 15:29972030-29972052 TGTTTTCAACAAATGCACCAGGG - Intergenic
1128030548 15:64476251-64476273 GATCTTAAACAACTAGAACAGGG - Intronic
1130385821 15:83411074-83411096 GGGTTTAACCACATTGACCAGGG + Intergenic
1130842526 15:87714818-87714840 GGTTTTATATTAATATACCATGG - Intergenic
1130874530 15:88001570-88001592 TCTTTTAAACAAATAGTCCTGGG - Intronic
1131726623 15:95233657-95233679 GATTATATACAAATATACCAGGG + Intergenic
1135738040 16:24948925-24948947 GGTTTTAAGAAAATTTACCATGG - Intronic
1138747213 16:59377168-59377190 TGTTTTAAACATATTGTCCAGGG + Intergenic
1138824795 16:60306116-60306138 AGTTTTAAAAAAATAAACAATGG - Intergenic
1138888077 16:61105265-61105287 TGATTTTAACAAATATACCAAGG - Intergenic
1140319463 16:73934779-73934801 GGTTACAGACACATAGACCAAGG + Intergenic
1140574450 16:76149427-76149449 GTTTTTAAACAAATGAATCAAGG - Intergenic
1140750938 16:78022939-78022961 GGTTTTAAAAAAAAACAACAGGG + Intronic
1141572721 16:84943943-84943965 GGCTTCTAACAAATAGAACATGG + Intergenic
1141874512 16:86813426-86813448 GCTTTTAAATAAATAGTCCTGGG + Intergenic
1141973653 16:87499400-87499422 GTTTTTGAACAAACATACCAGGG + Intergenic
1143702861 17:8674506-8674528 TGTTTTAAACAAACATCCCAAGG + Intergenic
1147196818 17:38772031-38772053 TGTTTTAAAAAAAGAGGCCATGG + Intronic
1149340601 17:55682304-55682326 GAATTTAAACAAAGAGCCCAGGG + Intergenic
1150867441 17:68868250-68868272 TGTTTTATACACATATACCATGG + Intronic
1150998800 17:70350239-70350261 GGATTTAAACAAATTTACAAGGG + Intergenic
1151911465 17:77086265-77086287 GGTGTGTAACAAATAGCCCAGGG + Intergenic
1152364671 17:79848706-79848728 GGTGTTAAGCAATTGGACCAAGG + Intergenic
1153705820 18:7744677-7744699 TTTTTCAGACAAATAGACCAAGG - Intronic
1155598839 18:27519437-27519459 GATTTTTGACAAATATACCAAGG - Intergenic
1155865429 18:30959353-30959375 ACTTTTAAAAAGATAGACCAAGG - Intergenic
1156295583 18:35786782-35786804 GGTTTTAAAGAAATAGAAGAGGG + Intergenic
1159075019 18:63670826-63670848 GGTTTTTAACAAAGATGCCAAGG - Intronic
1159882619 18:73873622-73873644 GTTTTTAAACAGAAAGACAAGGG + Intergenic
1159894701 18:73985337-73985359 TGATTAAAATAAATAGACCAAGG + Intergenic
1162139164 19:8575549-8575571 GGTTTCTAACAGACAGACCATGG + Intronic
1163039776 19:14593657-14593679 GTCTTTAAAAAAATAGAACACGG + Intronic
1167709523 19:51101596-51101618 GTTTTTTACCATATAGACCAGGG - Intronic
926697150 2:15778822-15778844 AGTTTTAAACAAATGCACTATGG + Intergenic
927637983 2:24829879-24829901 GGTTCTAAACCAATAGATCTGGG + Intronic
928497344 2:31847349-31847371 GGTTTTCAATAAATGTACCAAGG - Intergenic
928817251 2:35312988-35313010 TCTTTAAAACAAATAGAACAAGG + Intergenic
930152129 2:48069790-48069812 GGTTTTAAATAAAAATACCTGGG + Intergenic
931769278 2:65483828-65483850 GATTTTAACCAAATATAGCAAGG - Intergenic
935291943 2:101618457-101618479 GGTTTTAAACCAACAGAGCCTGG + Intergenic
935445027 2:103147224-103147246 GAGTTTAAAGAAATAGATCAAGG + Intergenic
938877062 2:135543030-135543052 GCTTTAAAACATTTAGACCAGGG - Intronic
940482609 2:154254167-154254189 GGATGTGAACAAATATACCAAGG + Intronic
942096660 2:172541075-172541097 GTTTTTCCACAAATAGAACATGG + Intergenic
942607068 2:177703801-177703823 AGCTTTTAACAAATACACCATGG + Intronic
942672036 2:178386391-178386413 GGTTGTTAAGATATAGACCAGGG - Intronic
943201989 2:184839896-184839918 GTTTTTAAAAAAATAGAATAAGG + Intronic
943729419 2:191286051-191286073 GGTTTTAAATAACTTGCCCAAGG - Intronic
945077668 2:206056500-206056522 GGTTTTAAAGAAGTAGATAAAGG + Exonic
945745525 2:213716005-213716027 GGCCTTAAACAAATAGATGAGGG - Intronic
1169465146 20:5831251-5831273 GGTTCTTCACAAAAAGACCATGG - Intronic
1169725685 20:8726916-8726938 GGGTTTAACAAAAGAGACCATGG - Intronic
1169755570 20:9039787-9039809 GGCTTAAAACAAATGGGCCATGG - Intergenic
1171341895 20:24436109-24436131 GGAGTTAAACAAATTGTCCAAGG - Intergenic
1172246087 20:33445896-33445918 GGTTTTAAAAAAAGAACCCAGGG + Intergenic
1174760891 20:53206465-53206487 GGGTTAAAACAAATAGAGAAGGG + Intronic
1175032004 20:55963852-55963874 TGTTTTTAACCAATAGACTATGG + Intergenic
1175715159 20:61250696-61250718 TATTTTAAGAAAATAGACCAGGG + Intergenic
1177027586 21:15938587-15938609 GATTTTCAAGAAATATACCAAGG - Intergenic
1178556022 21:33590748-33590770 AACTTTAAACAAATATACCATGG + Intronic
1178889728 21:36510909-36510931 GGTTCTTAATAAGTAGACCAGGG - Intronic
1182381968 22:29898220-29898242 TGTTTTCAACAAATATACAAAGG + Intronic
1183119637 22:35720372-35720394 GATTTTAAACAAACAAACCATGG - Intronic
949275950 3:2281396-2281418 GGCTTAAAATAAATAGGCCATGG - Intronic
950825199 3:15811751-15811773 GGTTTTAAAAAAATTGTCCCTGG - Intronic
950960884 3:17105711-17105733 GGTTTTAAACAATTTAACTATGG - Intergenic
951530195 3:23691817-23691839 GGCTTCTAACAAATAGAACATGG - Intergenic
953718014 3:45332595-45332617 GGTGTTAAACAACTTGCCCAAGG + Intergenic
954910329 3:54101215-54101237 GATTTTGAACAAAGAGTCCAAGG - Intergenic
955691716 3:61597502-61597524 TATTCTAAACTAATAGACCAGGG - Intronic
956340816 3:68221911-68221933 AGTGTTCAACAAATACACCATGG - Intronic
956849594 3:73216836-73216858 GATTTTCAACAAAAATACCAAGG + Intergenic
958742206 3:98088303-98088325 GTTTTTAAAGAAATCAACCATGG - Intergenic
960390102 3:117066801-117066823 AATTTTAAACCAATAGCCCAGGG + Intronic
961463472 3:127067696-127067718 GGTATTAAACAGATACTCCACGG - Intergenic
962210660 3:133474821-133474843 GGTTTTAAATAATTACTCCATGG - Intronic
963506558 3:146192347-146192369 GCTTTTAAATAAATATACAATGG - Exonic
964036280 3:152201812-152201834 GATTATAAACAAATAAAGCAGGG - Intergenic
964331135 3:155604588-155604610 GGTTTAATACAAATAGAAAAAGG - Intronic
965084065 3:164071642-164071664 AGTTTTAAATAAATATAACAAGG - Intergenic
966131434 3:176644984-176645006 GGATATAAACATTTAGACCATGG - Intergenic
966690241 3:182734140-182734162 GTTTTTAAACAAATTAACTATGG - Intergenic
966931557 3:184678860-184678882 GACTTTAAACAAACAGTCCATGG + Intronic
967637510 3:191820569-191820591 TGGGTTAAACAAATAGACCATGG - Intergenic
968267876 3:197376686-197376708 GGTTTTAAAAAGATAGACGTGGG - Intergenic
968420644 4:481496-481518 GATTTTTAATAAATGGACCAAGG - Intronic
971808525 4:31393423-31393445 CTTTTTAAACAAATAGAACTTGG + Intergenic
972389928 4:38604930-38604952 TGTTTTAAACAAATTGAAGAGGG - Intergenic
975045366 4:69796650-69796672 ACTTTTAAACAACTAGATCATGG - Intergenic
975366058 4:73529152-73529174 GTGTTTCAACAAATAGAGCATGG - Intergenic
975809698 4:78154386-78154408 GGTTTTAAACAAATAGACCAAGG - Intronic
978065282 4:104391733-104391755 GCTTTTAAACAAGTACACCCAGG + Intergenic
978889758 4:113810554-113810576 GGTTTTAAACAAACACACAGTGG - Intergenic
978907415 4:114023720-114023742 TTTTTTAAACTAGTAGACCATGG - Intergenic
980563202 4:134503620-134503642 GGGTTTGAACAAAGAGACAAAGG - Intergenic
981353488 4:143759565-143759587 TTTTTTAAACAAATATACCAAGG - Intergenic
982023720 4:151231235-151231257 GATTCCAAACAAATAGACCATGG + Intronic
982756573 4:159226258-159226280 GATTTTAAACAAACATGCCAAGG - Intronic
983601296 4:169532401-169532423 GGATTTAAACAAATATATAATGG - Intronic
984003355 4:174278780-174278802 GCTTTTATACAAATAAAACAAGG + Intronic
984559512 4:181252064-181252086 GGGTTTAAACAAGTAGATGATGG - Intergenic
984672982 4:182513535-182513557 GGTTTTTAAAAAATAGATCTGGG + Intronic
984937112 4:184899019-184899041 GGGTTTGAACAAACAGCCCAAGG + Intergenic
985907495 5:2852409-2852431 GTTTTTAAAAAAATACACCAAGG - Intergenic
986196665 5:5542990-5543012 GCTTTTAGGCAAATAGAGCACGG + Intergenic
987133380 5:14879720-14879742 GGTATTAAACAAAAAGATGAGGG + Intergenic
988096980 5:26627741-26627763 GGTTTTAAACATATAGTTCTTGG + Intergenic
989604949 5:43235129-43235151 TGATTTAAACATATAGACAAGGG + Intronic
989791864 5:45414038-45414060 GATATTAATCAATTAGACCATGG + Intronic
991572216 5:68067054-68067076 GTTTTTAAAAAATTAGACAAAGG - Intergenic
992070921 5:73148241-73148263 TTTTTTAAATAAATAGGCCAAGG + Intergenic
994946786 5:106404243-106404265 GTTTATAAACAAAGATACCAAGG - Intergenic
995349083 5:111154860-111154882 GGTCTGAAACAAATTCACCAGGG - Intergenic
996657832 5:125962719-125962741 GCTTTTAAGCAAATAGAAGAAGG + Intergenic
999892222 5:155991128-155991150 GATATTAAACAATTAGGCCAAGG - Intronic
1000882322 5:166712616-166712638 ATTTTTAAACAGATAAACCAGGG - Intergenic
1003364798 6:5462660-5462682 GATTTTCAACAAAGATACCAAGG - Intronic
1003570186 6:7250921-7250943 GGTTTTAACTAAGTAGGCCAAGG - Exonic
1004985028 6:21071670-21071692 GGTTTTTAAAAAATAAACAATGG - Intronic
1005322147 6:24666215-24666237 GGTTTGAAACAAATGAACGAAGG - Intronic
1006187806 6:32190568-32190590 GGTTTTAATTAAGTAGAACAGGG - Intergenic
1007190156 6:40008464-40008486 GGGTTTAAAAAAATAGAATAAGG - Intergenic
1007337695 6:41166061-41166083 GATTTTCAACAAATACACTAAGG - Intergenic
1009765028 6:68061824-68061846 GGTTTTAAAGATTTAGTCCAAGG - Intergenic
1009835255 6:68992213-68992235 GGTTTTTAAAGAAGAGACCATGG + Intronic
1010679996 6:78787721-78787743 GGTTTTCAACAAAAATACTAAGG + Intergenic
1011880351 6:92016306-92016328 AATTTTAAACAAATAGCACAAGG - Intergenic
1011968935 6:93197450-93197472 GGTTTTAAGCAATTTGATCATGG - Intergenic
1015297385 6:131612190-131612212 GGTTTTAACCAAAAACACCTGGG - Intronic
1015922561 6:138280410-138280432 GGTTTTACACCAACAGACAAAGG - Intronic
1017609852 6:156173975-156173997 GCTTTGAAACAAAGAGATCACGG + Intergenic
1021234782 7:18129249-18129271 GTTTTTAAACTGATATACCATGG + Intronic
1021521896 7:21547156-21547178 CGTTTAAAACAAATAGACCTGGG - Intronic
1021778526 7:24078507-24078529 GGTATTAAAGCAATAGACTAAGG - Intergenic
1023337476 7:39185509-39185531 GGTTTTATAAAAATAGAACCAGG + Intronic
1023527612 7:41120986-41121008 GGTTTTAAAAAAATGGAACCAGG + Intergenic
1026123123 7:67554866-67554888 GGTCTTAATCAAATAGACATGGG + Intergenic
1027941141 7:84680909-84680931 GGTTTTAGACCTATAGACTAAGG - Intergenic
1028847208 7:95495602-95495624 GGTTTTAAACTAATAGCTAATGG - Intronic
1029227980 7:99042019-99042041 AGTCTACAACAAATAGACCAAGG + Intronic
1029684699 7:102138864-102138886 GGATTTACACACATAGACAAAGG + Intronic
1030713455 7:112781614-112781636 GATTTTAAACAAAGACGCCAAGG + Intronic
1030765798 7:113408268-113408290 GGATTATAAAAAATAGACCATGG - Intergenic
1031685121 7:124723976-124723998 GATTTAAAACAAAAAGACCCTGG + Intergenic
1032142732 7:129348164-129348186 GGTGATAAACAAATAGCACAAGG + Intronic
1038427446 8:27473396-27473418 GGCTTTAAAAATATAAACCAAGG + Intronic
1041851020 8:62393377-62393399 GGTTTTCAACAAAGATACCAAGG - Intronic
1041941028 8:63388059-63388081 GGGTTTAGATAAATGGACCAAGG - Intergenic
1042657925 8:71120713-71120735 GCATTTAAACATATAGATCAAGG + Intergenic
1042846663 8:73175541-73175563 AGTTTTAAAAAAATAGAGTATGG + Intergenic
1043632029 8:82347336-82347358 GGTTATAAAGAAAAAGACCATGG - Intergenic
1044354924 8:91209827-91209849 GGTTTTAAACAACTAGAAGATGG + Intronic
1047512609 8:125527233-125527255 CTTTTTAAAAAAATAGATCAAGG - Intergenic
1052454142 9:28672705-28672727 CATTTCAAACAAATAGATCATGG - Intergenic
1056603837 9:88068420-88068442 GGTCTGAAACAAATTCACCAGGG + Intergenic
1057356747 9:94338264-94338286 GGTCTAAAACAAATACACCAAGG - Intergenic
1057651006 9:96919380-96919402 GGTCTAAAACAAATACACCAAGG + Intronic
1058241303 9:102564627-102564649 GATTTAAAACAAATAGAACTGGG - Intergenic
1059361951 9:113751089-113751111 GCTTTCAAACATAAAGACCAAGG - Intergenic
1060039060 9:120284067-120284089 GTTTATATACAAATACACCAAGG + Intergenic
1186532461 X:10311040-10311062 GGATTTAAGGAAATGGACCAGGG + Intergenic
1186570366 X:10708785-10708807 TGCTTTAAACAACTAGAGCATGG + Intronic
1186595309 X:10974973-10974995 AGGTTTAAACAAGTTGACCAAGG - Intergenic
1186658021 X:11636961-11636983 TATTTTAAACAAATTGATCATGG - Intronic
1187465834 X:19526854-19526876 TGTTTCAACCAAATAGACTACGG + Intergenic
1187527421 X:20066714-20066736 GGGTTTAAACAGATGGAGCAGGG - Intronic
1190378174 X:49811695-49811717 GTTTTTAGACAAATAGAGGAAGG + Intergenic
1190934138 X:54979511-54979533 GATTTAAAACAAATAAAGCATGG + Intronic
1192146579 X:68686692-68686714 GGTTTTAGACAAATGGACATAGG - Intronic
1199807391 X:151313871-151313893 GGATTTAAATAAATAAAACAAGG - Intergenic
1201310523 Y:12594932-12594954 GGTTTTTAAGAAACAGAGCATGG + Intergenic