ID: 975811972

View in Genome Browser
Species Human (GRCh38)
Location 4:78178950-78178972
Sequence CAGATGTTCGAGGGGAGCGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975811965_975811972 -2 Left 975811965 4:78178929-78178951 CCCCTAACTACCGCTGATGCACA 0: 1
1: 0
2: 1
3: 4
4: 31
Right 975811972 4:78178950-78178972 CAGATGTTCGAGGGGAGCGAAGG No data
975811962_975811972 3 Left 975811962 4:78178924-78178946 CCCACCCCCTAACTACCGCTGAT 0: 1
1: 0
2: 0
3: 13
4: 137
Right 975811972 4:78178950-78178972 CAGATGTTCGAGGGGAGCGAAGG No data
975811963_975811972 2 Left 975811963 4:78178925-78178947 CCACCCCCTAACTACCGCTGATG 0: 1
1: 0
2: 0
3: 5
4: 87
Right 975811972 4:78178950-78178972 CAGATGTTCGAGGGGAGCGAAGG No data
975811964_975811972 -1 Left 975811964 4:78178928-78178950 CCCCCTAACTACCGCTGATGCAC 0: 1
1: 0
2: 0
3: 3
4: 38
Right 975811972 4:78178950-78178972 CAGATGTTCGAGGGGAGCGAAGG No data
975811966_975811972 -3 Left 975811966 4:78178930-78178952 CCCTAACTACCGCTGATGCACAG 0: 1
1: 0
2: 0
3: 4
4: 59
Right 975811972 4:78178950-78178972 CAGATGTTCGAGGGGAGCGAAGG No data
975811967_975811972 -4 Left 975811967 4:78178931-78178953 CCTAACTACCGCTGATGCACAGA 0: 1
1: 0
2: 0
3: 5
4: 76
Right 975811972 4:78178950-78178972 CAGATGTTCGAGGGGAGCGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975811972 Original CRISPR CAGATGTTCGAGGGGAGCGA AGG Intronic
No off target data available for this crispr