ID: 975815101

View in Genome Browser
Species Human (GRCh38)
Location 4:78209310-78209332
Sequence CACCAGTGCATGCAACCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 154}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975815101_975815104 -6 Left 975815101 4:78209310-78209332 CCTGGAGGTTGCATGCACTGGTG 0: 1
1: 0
2: 1
3: 16
4: 154
Right 975815104 4:78209327-78209349 CTGGTGGGCCCCTTCCCTTCTGG 0: 1
1: 0
2: 2
3: 20
4: 188
975815101_975815108 5 Left 975815101 4:78209310-78209332 CCTGGAGGTTGCATGCACTGGTG 0: 1
1: 0
2: 1
3: 16
4: 154
Right 975815108 4:78209338-78209360 CTTCCCTTCTGGCTTCCTGTTGG 0: 1
1: 0
2: 10
3: 88
4: 479
975815101_975815109 6 Left 975815101 4:78209310-78209332 CCTGGAGGTTGCATGCACTGGTG 0: 1
1: 0
2: 1
3: 16
4: 154
Right 975815109 4:78209339-78209361 TTCCCTTCTGGCTTCCTGTTGGG No data
975815101_975815112 18 Left 975815101 4:78209310-78209332 CCTGGAGGTTGCATGCACTGGTG 0: 1
1: 0
2: 1
3: 16
4: 154
Right 975815112 4:78209351-78209373 TTCCTGTTGGGTGTAAGCAATGG 0: 1
1: 0
2: 1
3: 15
4: 231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975815101 Original CRISPR CACCAGTGCATGCAACCTCC AGG (reversed) Intronic
900501001 1:3004577-3004599 CACCGGTGCATGGGACATCCTGG - Intergenic
900615323 1:3563084-3563106 CAACAGAGCAGGCAGCCTCCAGG - Intronic
904197358 1:28795765-28795787 GAGAAGTGCATGCCACCTCCTGG + Intergenic
904919575 1:33996548-33996570 TTCCAGTCCATGCAAGCTCCTGG - Intronic
904931308 1:34089551-34089573 CTCCATTGTCTGCAACCTCCTGG + Intronic
907564910 1:55425647-55425669 AATCAGTGCATCCAACCTCTAGG - Intergenic
917419727 1:174850213-174850235 CACCAGTGCAGGAAACCTCCGGG + Intronic
919980459 1:202639762-202639784 GACTAGAGCATGCAAACTCCTGG + Intronic
924557391 1:245129702-245129724 CATCAGTGCCTGCACCTTCCAGG + Intergenic
1063444960 10:6107250-6107272 CACCACAACCTGCAACCTCCTGG + Intronic
1064106066 10:12502044-12502066 CACCAGGGCAGGCAGCCACCAGG + Intronic
1065603353 10:27392004-27392026 CCCCAGTACATGCAACATGCAGG + Intergenic
1072453909 10:95560379-95560401 CACCAGTGCATGCTTTCTCCAGG - Intronic
1076760785 10:132605009-132605031 CACAAGTGGATCCACCCTCCAGG - Intronic
1077170997 11:1165649-1165671 TACCCGGGCATGGAACCTCCTGG - Exonic
1077336645 11:2008082-2008104 CACCCGTGCATGCCACTTACAGG + Intergenic
1078521426 11:12066926-12066948 CACCAGGGCAGGCAGCCTCGTGG - Intergenic
1078687808 11:13549373-13549395 CACCACTGCCTGCAACATCCTGG - Intergenic
1078721045 11:13883434-13883456 CACCAGTGCCTGCCACTTACGGG - Intergenic
1081769786 11:45642577-45642599 CAACAGTGCCTGGAACCTGCAGG + Intergenic
1081777595 11:45686193-45686215 CACCAGAACACCCAACCTCCAGG - Intergenic
1081907147 11:46677373-46677395 CAGCAGTGCATCCAGCCCCCTGG - Exonic
1084800258 11:71538960-71538982 CCCCGGTCCCTGCAACCTCCTGG + Exonic
1085954780 11:81378591-81378613 CACCTGTGAAGACAACCTCCAGG + Intergenic
1089561372 11:119344949-119344971 CACCAATGCCAGCCACCTCCTGG - Exonic
1089686839 11:120156020-120156042 CACGAGTGCATTCTACCCCCAGG - Intronic
1090230871 11:125102655-125102677 CACCAGGGCATGGGAACTCCAGG + Exonic
1202819629 11_KI270721v1_random:63264-63286 CACCCGTGCATGCCACTTACAGG + Intergenic
1093997157 12:25654888-25654910 CCTCAGTGCATGCACACTCCTGG + Intergenic
1095917460 12:47494436-47494458 CAGTAGTGGAGGCAACCTCCTGG + Intergenic
1096342436 12:50812747-50812769 CACCACTGCACTCTACCTCCTGG - Intronic
1100275694 12:93069899-93069921 CCTCACTGTATGCAACCTCCTGG - Intergenic
1104568850 12:129907949-129907971 TTCCAGTGCATGCAAAATCCAGG - Intergenic
1106803362 13:33280055-33280077 TGCCAGTGCATTCACCCTCCAGG + Intronic
1113918401 13:113888652-113888674 CACCAGTGCTTCCAACCTTCTGG - Intergenic
1116814134 14:49567970-49567992 ATCCAGTGGAAGCAACCTCCAGG - Intergenic
1118681500 14:68246196-68246218 CACCATTCCATGAAGCCTCCTGG + Intronic
1121834633 14:97080719-97080741 CACCTGTGCAGACAACCTCATGG + Intergenic
1124496158 15:30188589-30188611 GACCAGAGCATGCAAACTCCTGG + Intergenic
1124747416 15:32350058-32350080 GACCAGAGCATGCAAACTCCTGG - Intergenic
1125648403 15:41292793-41292815 CACCAGTGATTGCTGCCTCCTGG - Intergenic
1126288066 15:47038833-47038855 CAGAAGTGCATTCAACATCCTGG + Intergenic
1127689045 15:61376716-61376738 CAGCACTGAATGCTACCTCCAGG - Intergenic
1130153081 15:81326091-81326113 TACAAATGTATGCAACCTCCTGG + Intergenic
1130580579 15:85134104-85134126 GACAAGTGCATGGAACGTCCAGG - Intronic
1131143868 15:89999757-89999779 CCCCAGTGACTGCAGCCTCCCGG - Intergenic
1132263884 15:100449234-100449256 CACCTGCACATGCAACCTGCAGG + Intronic
1136707288 16:32200976-32200998 CACCACTTCATGCAGCTTCCTGG + Intergenic
1136760622 16:32728441-32728463 CACCACTTCATGCAGCTTCCTGG - Intergenic
1136807481 16:33141945-33141967 CACCACTTCATGCAGCTTCCTGG + Intergenic
1137598949 16:49743384-49743406 CTCCTGGGCATGCAAGCTCCAGG + Intronic
1138272993 16:55709657-55709679 CCTGAGTGCATGCAACCACCTGG + Intergenic
1141384099 16:83603585-83603607 CATCAATGCTTCCAACCTCCAGG + Intronic
1141448454 16:84079782-84079804 CATGAGTTCATGCCACCTCCAGG - Intronic
1142033588 16:87850497-87850519 CACCAGAGCGTGCATCCGCCGGG + Intronic
1142157209 16:88538022-88538044 CACCAGTGCAAGCACCCCCCTGG + Intergenic
1203062774 16_KI270728v1_random:988755-988777 CACCACTTCATGCAGCTTCCTGG - Intergenic
1142672128 17:1492088-1492110 GACCAGGGCATGGAAGCTCCAGG - Intronic
1143321605 17:6072037-6072059 CACCTGTGGCTGCATCCTCCAGG + Intronic
1143393110 17:6571850-6571872 CTCCAATGCATTCAGCCTCCTGG + Intergenic
1151986368 17:77546746-77546768 AAACAGTGCATGCACCCACCAGG + Intergenic
1155540993 18:26868050-26868072 CACCAGAGCTTCCCACCTCCTGG - Intergenic
1157161268 18:45316323-45316345 CTGCAGTGCAGGCAGCCTCCTGG - Intronic
1163821799 19:19500268-19500290 CACCAGAGCATGTAAGCTGCAGG + Intronic
1164422357 19:28106032-28106054 CACCATTGCCTGCACCATCCTGG + Intergenic
1164615067 19:29662874-29662896 GACCAGTGCGTGCTGCCTCCAGG + Intergenic
1165299715 19:34961089-34961111 AACCAGGGCCTGCTACCTCCTGG - Intronic
1167003866 19:46762656-46762678 CATCAGTCCATCCAACATCCGGG - Intronic
1168173919 19:54609123-54609145 CACCATTGCCAGCAACCCCCTGG + Intronic
925291035 2:2748871-2748893 CACACGTGCATGGAGCCTCCTGG - Intergenic
926582935 2:14651382-14651404 CCCCAGTCCTTGCCACCTCCTGG + Intergenic
927468984 2:23358214-23358236 CTCCAGTGGTTGCAACCTCTGGG + Intergenic
931326763 2:61233793-61233815 CACCACTGCATTCAACAGCCTGG + Intronic
932000951 2:67883956-67883978 CACAAATGCATCCAAGCTCCTGG + Intergenic
935949662 2:108317133-108317155 CACCACTGCCTGCAACACCCTGG + Intergenic
936879441 2:117232450-117232472 CACCATTGCTTGCAACACCCTGG - Intergenic
939305184 2:140401833-140401855 CACCATTGCCTGCAACACCCTGG + Intronic
942042475 2:172080165-172080187 CCACAGTCCATGCATCCTCCAGG - Exonic
948590887 2:239049416-239049438 GTACAGTCCATGCAACCTCCAGG + Exonic
948857685 2:240737684-240737706 CCCCAGTGCATGCAACTTAGCGG - Intronic
1173899519 20:46576995-46577017 CACAGGTGCATGCAACCCACAGG + Intronic
1173899533 20:46577097-46577119 CACAGGTGTATGCAACCTACAGG + Intronic
1174082934 20:47983621-47983643 CACCAGTGCAGGCCTGCTCCTGG - Intergenic
1174303563 20:49599677-49599699 CACCAGTGAATCCAGACTCCAGG - Intergenic
1175955061 20:62604957-62604979 CACCCGTGCATGCCACCTGCCGG + Intergenic
1176141302 20:63546283-63546305 CACCCGCCCATGCAACCCCCAGG + Intronic
1178145606 21:29736369-29736391 CACAGGTGCATGCTACCACCTGG + Intronic
1178253251 21:31025061-31025083 TACCGGTGCATGCAGCCCCCAGG + Intergenic
1179056957 21:37945096-37945118 CACCTGTGCATCCTAACTCCTGG - Intergenic
1181001303 22:19988972-19988994 CACCAGGGCATCAACCCTCCGGG + Intronic
1184072557 22:42154981-42155003 CACCAGTGCATCCAGCCCCATGG + Intergenic
1185069685 22:48649200-48649222 GAGCAGTGCACGCAACCCCCAGG - Intronic
1185397135 22:50598587-50598609 CACCACTGCATCCAACCTGGGGG - Intronic
949096918 3:97234-97256 CACCATTGAATGCTAACTCCAGG + Intergenic
950497068 3:13340182-13340204 CCCCAGTGCAGGCCACCACCTGG - Intronic
950934069 3:16821100-16821122 CAAGTGTCCATGCAACCTCCAGG - Intronic
951676747 3:25250128-25250150 CACCTGTACATGCCACCTGCAGG - Intronic
955582384 3:60438187-60438209 CACATGTGCATGCTCCCTCCAGG - Intronic
961016184 3:123470019-123470041 CAGCAGTGCAGGTAACCTCAAGG - Intergenic
964343395 3:155731428-155731450 CGCCAGTGGATCCAAGCTCCTGG + Intronic
965659740 3:171028814-171028836 CACCAGTGCCTGCAATCACCCGG + Intergenic
969512169 4:7624568-7624590 CAGCAGTGCTGGCAGCCTCCTGG - Intronic
969718188 4:8878440-8878462 CACCAGAGCATCCATCCTCCAGG - Intergenic
975815101 4:78209310-78209332 CACCAGTGCATGCAACCTCCAGG - Intronic
979434659 4:120673992-120674014 CACCACTGCCTGCAACATCCTGG + Intergenic
983776173 4:171609958-171609980 TACCACTGCCTGCAACATCCTGG + Intergenic
985664536 5:1175227-1175249 CACCAGTGGCTGCAGGCTCCAGG - Intergenic
986539477 5:8828711-8828733 CACCACTGCCTGCATCATCCTGG + Intergenic
990989725 5:61673346-61673368 CACCAGTCCATGCACACTGCAGG - Intronic
991414664 5:66379769-66379791 CACCACTGCCTGCAACACCCTGG + Intergenic
995066786 5:107871532-107871554 GCCAAGTGCATGCAAGCTCCAGG + Intronic
995530551 5:113087603-113087625 CTCCGGTGAATTCAACCTCCCGG + Intronic
998703452 5:144731842-144731864 TACCACTGCCTGCAACATCCTGG - Intergenic
998977697 5:147666522-147666544 CATCAGTCCATTTAACCTCCCGG + Intronic
1001236341 5:170032630-170032652 CAGCTGTGCATGCCTCCTCCTGG - Intronic
1002297833 5:178241268-178241290 CACCAGTGCCTGAAACCACTGGG + Intronic
1002599177 5:180344682-180344704 CACCGGTGCTTGAACCCTCCTGG + Intronic
1002809527 6:613694-613716 CAGCAGTGGATGCCTCCTCCCGG - Intronic
1004956949 6:20738116-20738138 CACCACTACAAGCAACCTCTAGG - Intronic
1007704750 6:43783878-43783900 TACCTGGGCCTGCAACCTCCAGG + Intronic
1007787247 6:44287676-44287698 CACCAGTCCCTGCAAAGTCCAGG - Exonic
1010554228 6:77259040-77259062 CACAAGTGCATGCTACCAACAGG + Intergenic
1011589000 6:88952576-88952598 TACCACTGCCTGCAACATCCTGG + Intronic
1012473199 6:99593108-99593130 CCCCAGTGAATTGAACCTCCTGG - Intergenic
1012585994 6:100923228-100923250 CACCAGTGAATTCCACCTCTGGG - Intergenic
1013255299 6:108379367-108379389 CACCTGTGCATGCCATCTACAGG - Intronic
1014420949 6:121245086-121245108 CACCACTGCCTGCAACACCCTGG + Intronic
1016031678 6:139344478-139344500 CACCATTGCATGCAGCACCCTGG + Intergenic
1017863471 6:158421421-158421443 CACCATAGCCTGGAACCTCCCGG - Intronic
1024518875 7:50285245-50285267 CACAAATGAGTGCAACCTCCTGG + Intergenic
1029697092 7:102220699-102220721 CACCAGTCCCCGCCACCTCCAGG + Intronic
1031239574 7:119220002-119220024 CCCCAGTGCATCCAGGCTCCAGG - Intergenic
1033462719 7:141562192-141562214 TACCACTGCCTGCAACATCCTGG - Intronic
1033660574 7:143399255-143399277 CACCTGTGCATGCCACCTGGGGG + Exonic
1043448624 8:80343764-80343786 TACCAGTACATGCAACATCATGG - Intergenic
1044653515 8:94523865-94523887 CACCAGAACCTCCAACCTCCCGG + Intronic
1048990574 8:139757916-139757938 CATCAGGGCATGCAGCCTCCTGG - Intronic
1049281921 8:141753757-141753779 CACCAGCGAATGCAGCCTGCAGG - Intergenic
1049300196 8:141865661-141865683 CACCGGTGCATGCCACGGCCTGG - Intergenic
1049615661 8:143574868-143574890 CACCAGGGCCTGCAGCCTCTCGG + Exonic
1050882364 9:10718632-10718654 TACCAGTGCAGGGAAGCTCCTGG - Intergenic
1053440354 9:38111176-38111198 CACCACTGCATTCCAGCTCCAGG - Intergenic
1053826239 9:42027455-42027477 CCCCACTGCATGAATCCTCCAGG + Intronic
1054604322 9:67159942-67159964 CCCCACTGCATGAATCCTCCAGG - Intergenic
1056265645 9:84894100-84894122 CACCAGTGCATGCAATTGCCAGG - Intronic
1056534651 9:87516989-87517011 CACCAGTACATGCCACTTCAGGG + Intronic
1056732987 9:89181881-89181903 CCCCAGTGGAGGCATCCTCCAGG + Intergenic
1057275610 9:93674625-93674647 CCCCAGTGCCTGCAAGCCCCTGG - Intronic
1057818796 9:98315618-98315640 CACCTGAGCATGCAACCTGCAGG + Intronic
1060842691 9:126805915-126805937 CACCAGTGCAGGGAACTTCACGG - Intronic
1062154550 9:135039410-135039432 CACTCGTGCATGCATCCACCTGG - Intergenic
1062390803 9:136333152-136333174 CAGCTGTGCCTGCCACCTCCTGG + Intronic
1062527598 9:136984602-136984624 CAGCAGTCCATGCAGCCTCCAGG - Intronic
1187555235 X:20344916-20344938 CACCAGTCCATGCAAGCAGCTGG + Intergenic
1187906814 X:24074538-24074560 CATCAGTGGATGCTACATCCAGG - Intronic
1190441738 X:50481712-50481734 CCCCAGTGGATACCACCTCCTGG - Intergenic
1190691013 X:52913255-52913277 CACTAGTGCATGCACCCACAGGG - Intergenic
1190694970 X:52942537-52942559 CACTAGTGCATGCACCCACAGGG + Intronic
1192232706 X:69277048-69277070 CTCCAGTTCAAGCAACCTCTTGG - Intergenic
1192743767 X:73918528-73918550 TACCGGTGCATGCAGCCCCCAGG - Intergenic
1192771454 X:74195840-74195862 CACTTGTGGATGGAACCTCCAGG - Intergenic
1194181476 X:90715945-90715967 TACCACTGCCTGCAACATCCTGG + Intergenic
1194384489 X:93236409-93236431 CAACATTGCCTGCAACATCCTGG + Intergenic
1194564686 X:95470139-95470161 AAACAGTGCAAGCAACCTCTAGG + Intergenic
1196599451 X:117585064-117585086 CACCACTGCCTGCAACACCCTGG - Intergenic
1196977869 X:121180040-121180062 TACCACTGCCTGCAACATCCTGG - Intergenic
1197262619 X:124334056-124334078 CACCAGGGTGTGCATCCTCCGGG - Intronic
1197641044 X:128968374-128968396 CACCAGTGCATACAACCCTAGGG + Intergenic
1198479799 X:137030997-137031019 CAGCAGAGCATGCTGCCTCCGGG + Exonic
1199298557 X:146186647-146186669 CACCACTGCTTGCAACATCCTGG - Intergenic
1200528101 Y:4297860-4297882 TACCACTGCCTGCAACATCCTGG + Intergenic
1200734518 Y:6779980-6780002 TACCAGTGCATGCAGCCCCCAGG + Intergenic