ID: 975817704

View in Genome Browser
Species Human (GRCh38)
Location 4:78236181-78236203
Sequence GACAACTTGGTCAACACTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 77}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975817704_975817713 12 Left 975817704 4:78236181-78236203 CCAATAGTGTTGACCAAGTTGTC 0: 1
1: 0
2: 0
3: 8
4: 77
Right 975817713 4:78236216-78236238 ATAGGTGAGGATCAGATTATGGG 0: 1
1: 0
2: 0
3: 8
4: 132
975817704_975817710 -1 Left 975817704 4:78236181-78236203 CCAATAGTGTTGACCAAGTTGTC 0: 1
1: 0
2: 0
3: 8
4: 77
Right 975817710 4:78236203-78236225 CAAGGCCAGGGAGATAGGTGAGG 0: 1
1: 0
2: 1
3: 36
4: 451
975817704_975817712 11 Left 975817704 4:78236181-78236203 CCAATAGTGTTGACCAAGTTGTC 0: 1
1: 0
2: 0
3: 8
4: 77
Right 975817712 4:78236215-78236237 GATAGGTGAGGATCAGATTATGG 0: 1
1: 0
2: 1
3: 9
4: 151
975817704_975817709 -6 Left 975817704 4:78236181-78236203 CCAATAGTGTTGACCAAGTTGTC 0: 1
1: 0
2: 0
3: 8
4: 77
Right 975817709 4:78236198-78236220 GTTGTCAAGGCCAGGGAGATAGG No data
975817704_975817714 13 Left 975817704 4:78236181-78236203 CCAATAGTGTTGACCAAGTTGTC 0: 1
1: 0
2: 0
3: 8
4: 77
Right 975817714 4:78236217-78236239 TAGGTGAGGATCAGATTATGGGG 0: 1
1: 0
2: 1
3: 14
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975817704 Original CRISPR GACAACTTGGTCAACACTAT TGG (reversed) Intronic
902353060 1:15872919-15872941 CACAACTCGGTCAACAAAATGGG + Exonic
903320387 1:22539428-22539450 GACCACATGCTCAATACTATGGG - Intergenic
904470570 1:30733633-30733655 CACAACTGGGTCAACGCTTTAGG - Exonic
905784136 1:40739309-40739331 TAGAACTTGGTAAAAACTATTGG + Intronic
915273068 1:154768817-154768839 GATAACATGGTCAAGACCATAGG + Intronic
918851913 1:189702730-189702752 TAAAACTTGGTCATCACTTTGGG + Intergenic
918891096 1:190269743-190269765 GACAACTTGGGCAAATCTATTGG + Intronic
922365251 1:224857255-224857277 GACAACTTGATCAACATTCTGGG + Intergenic
924092608 1:240516959-240516981 GAACACTTGGTGAACACTTTAGG + Intronic
924367290 1:243308702-243308724 GAAAACTTGGACAACACAAAAGG - Intronic
924741893 1:246799074-246799096 GTCCACTTGGTCAGCACTACGGG - Intergenic
1066450578 10:35524818-35524840 GACCACTTGGTCAAAACATTCGG + Intronic
1068546877 10:58357144-58357166 GACAACTTGCTCAAGACCATAGG - Intronic
1068879286 10:62031505-62031527 GACCACTTGGTAAAGACCATGGG + Intronic
1069351433 10:67531486-67531508 GACAAATTGGTCAAAACAAAGGG - Intronic
1070544413 10:77441357-77441379 GACTCCTTGGCCAACACTTTGGG - Intronic
1075233017 10:120700107-120700129 GACAAGTTGCTCAGCTCTATGGG + Intergenic
1080217321 11:29859790-29859812 GACAAGTGGGTAAACACTACCGG + Intergenic
1086737973 11:90330205-90330227 GAAAACATGCTCAACATTATTGG + Intergenic
1088842796 11:113640698-113640720 GACAGCTTGGGCAACATAATGGG + Intergenic
1092564023 12:9646802-9646824 GACAAATTGTACAACACTAATGG - Intergenic
1097108261 12:56638130-56638152 GACAACATAGTCAACACTGAAGG - Intergenic
1105386487 13:19934657-19934679 GACACCTTAGTAAACATTATTGG - Intergenic
1111693658 13:91595554-91595576 GACAACTTGGAAAACACAAGAGG - Intronic
1113817039 13:113179574-113179596 GGCTACTTGGTCAGCACTAAGGG + Intronic
1118020992 14:61713963-61713985 GACAACTTCTGCAACCCTATCGG - Intronic
1123984142 15:25630211-25630233 CACAACTTTGTCAAAACTATGGG + Intergenic
1127203403 15:56684263-56684285 TCCAACTTGTTAAACACTATAGG + Intronic
1130195250 15:81773233-81773255 GACAACTTGATCACCACTAAGGG - Intergenic
1134124498 16:11607130-11607152 GAAAACGTGGTCCACACTGTAGG - Intronic
1136924437 16:34358916-34358938 GATCACTTGGTTTACACTATTGG + Intergenic
1136980136 16:35052890-35052912 GATCACTTGGTTTACACTATTGG - Intergenic
1141249125 16:82338915-82338937 GAGAACTTGGTATACACAATTGG + Intergenic
1150830811 17:68517934-68517956 GAGAACTTGGTCAAAACAAGGGG + Intronic
1155756324 18:29501361-29501383 GACAAATTATTCAACATTATAGG + Intergenic
1160616231 18:80131319-80131341 GACACCCTTGTCTACACTATAGG + Intronic
1161050632 19:2162342-2162364 GAGATCTTGATCAACACTAAAGG + Intronic
1168655294 19:58123145-58123167 GAGAACTTGGTCAAAACAAAGGG + Intergenic
925887822 2:8408475-8408497 GATAACTTGGGCATCACTGTGGG - Intergenic
927608250 2:24508907-24508929 GACAACATGGTGATCACTTTAGG - Intronic
931943850 2:67283435-67283457 CACATCTTGGACAAGACTATTGG + Intergenic
939644440 2:144679408-144679430 GACAAATTTATAAACACTATAGG + Intergenic
939841314 2:147191077-147191099 CAGAACTTGAACAACACTATAGG + Intergenic
941897156 2:170640516-170640538 GTCAACTTGGTGACCACTAGTGG - Intronic
948225146 2:236303657-236303679 GATAATTTGGTAAACAGTATTGG + Intergenic
1170947336 20:20903026-20903048 GACAAAGTGGTTAACACCATGGG + Intergenic
1180669221 22:17540405-17540427 GACATCTTGGTATACTCTATAGG - Exonic
1181889439 22:26048936-26048958 CACAACCTCGCCAACACTATTGG + Intergenic
1185307304 22:50127109-50127131 GTCAACTTGGTCAACAGCAAAGG - Intronic
949710898 3:6870146-6870168 TACAAGTTGGTGAACATTATGGG + Intronic
949746959 3:7306515-7306537 GCCAACTTGGTCAGCTCTTTTGG - Exonic
949964228 3:9341618-9341640 GACAACTTGGTCAACTACTTGGG + Intronic
950322664 3:12070966-12070988 GACAGCCTGGTCATCACCATTGG + Intronic
952831326 3:37567661-37567683 GAAAAATTGGTCAAAACTAAAGG + Intronic
959147167 3:102562348-102562370 GAAGACTTGAACAACACTATAGG - Intergenic
962992911 3:140595713-140595735 GACACCTTGGTATAAACTATGGG - Intergenic
964662738 3:159138631-159138653 GAGAAATTGGTCATCACTCTGGG + Intronic
968280468 3:197473131-197473153 GAAAATGTGGTCAGCACTATTGG - Intergenic
975817704 4:78236181-78236203 GACAACTTGGTCAACACTATTGG - Intronic
975851157 4:78573920-78573942 GCCAGCTTGATCCACACTATGGG + Intronic
977360691 4:96000432-96000454 GAGAAATTGGCCAAAACTATGGG + Intergenic
984518521 4:180772226-180772248 GACAACATGGTAATGACTATTGG - Intergenic
984653022 4:182289834-182289856 AGCAACTTGGTCAACACGCTAGG - Intronic
994416375 5:99477027-99477049 GACAACTTGCACAGCACTCTAGG - Intergenic
994463591 5:100098146-100098168 GACAACTTGCACAGCACTCTAGG + Intergenic
996897724 5:128504598-128504620 GACAAATTGGTCAAAACAAAGGG - Intronic
998971855 5:147601329-147601351 GATGGCTTGGTCAACACTTTGGG + Intronic
1001272525 5:170325780-170325802 GACATCTTGTTCAACACTCTGGG - Intergenic
1004804992 6:19193791-19193813 TTCAACTTGGTTAACAGTATGGG + Intergenic
1010084959 6:71906273-71906295 GAGAATTTGCTCAACACTAAAGG - Intronic
1012885527 6:104841877-104841899 GACAATTTGGTTAAAACTTTGGG + Intronic
1013259847 6:108431053-108431075 GTCAACTTGGTCAAGACCTTGGG - Intronic
1013290937 6:108718128-108718150 TACATCTTGGTCAACTGTATTGG + Intergenic
1013903987 6:115192775-115192797 GACAACATGGTGAACCCAATGGG + Intergenic
1015722279 6:136255346-136255368 CTCAACTTGGGCAACACTTTAGG - Intergenic
1017161396 6:151369213-151369235 GACACCTTGGCCCACACTTTAGG + Intronic
1022781175 7:33585737-33585759 GACAACTAGATCCAGACTATGGG - Intronic
1034537237 7:151733075-151733097 GAGGGCTTGGTCAACACTCTTGG + Intronic
1043365116 8:79523617-79523639 GACAACTTAGACAATACTTTGGG - Intergenic
1046478080 8:114775622-114775644 GACAAATTTGTCATTACTATTGG + Intergenic
1046759579 8:118007439-118007461 GATAACTTGGTGAAAACTAGAGG + Intronic
1047389456 8:124438343-124438365 GACAACTTGTTCATCACCCTTGG - Intergenic
1187428566 X:19201361-19201383 GAGAAATTGGACAACACTTTGGG + Intergenic
1188269920 X:28126840-28126862 GTGAACTTGGTCAACACTTTAGG - Intergenic
1188543846 X:31279940-31279962 GACAACATAGTAAACACTATAGG - Intronic
1193445877 X:81601533-81601555 GAAAAGTTGATCAAAACTATGGG - Intergenic