ID: 975817709

View in Genome Browser
Species Human (GRCh38)
Location 4:78236198-78236220
Sequence GTTGTCAAGGCCAGGGAGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975817704_975817709 -6 Left 975817704 4:78236181-78236203 CCAATAGTGTTGACCAAGTTGTC 0: 1
1: 0
2: 0
3: 8
4: 77
Right 975817709 4:78236198-78236220 GTTGTCAAGGCCAGGGAGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975817709 Original CRISPR GTTGTCAAGGCCAGGGAGAT AGG Intronic
No off target data available for this crispr