ID: 975823202

View in Genome Browser
Species Human (GRCh38)
Location 4:78292622-78292644
Sequence GGTCCACCCAGGGCACAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 355
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 330}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975823202_975823208 20 Left 975823202 4:78292622-78292644 CCTGGCTGTGCCCTGGGTGGACC 0: 1
1: 0
2: 1
3: 23
4: 330
Right 975823208 4:78292665-78292687 AAACTACTGTTCTGAAATCCAGG 0: 1
1: 0
2: 2
3: 15
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975823202 Original CRISPR GGTCCACCCAGGGCACAGCC AGG (reversed) Intronic
900159961 1:1218811-1218833 CCTCCACCCCGAGCACAGCCGGG - Exonic
900189136 1:1345925-1345947 GCACCACCCAGGGGACAGGCTGG - Intronic
900516858 1:3086267-3086289 GGTGCGCCCAGGGCAGAGCCAGG - Intronic
900972579 1:5999770-5999792 GGTACAATCAGGGCACAGGCAGG - Intronic
900989771 1:6092967-6092989 GGTCCACCCTGAGCAGAACCTGG - Intronic
901686767 1:10947625-10947647 GGTGCACCCAGGACTCACCCTGG + Exonic
901769362 1:11522650-11522672 GGCCCAGCCAGAGCCCAGCCAGG + Intronic
901769374 1:11522683-11522705 AGCCCAGCCAGGGCCCAGCCAGG + Intronic
901769378 1:11522694-11522716 GGCCCAGCCAGGACCCAGCCAGG + Intronic
901769383 1:11522705-11522727 GACCCAGCCAGGGCCCAGCCAGG + Intronic
901769388 1:11522716-11522738 GGCCCAGCCAGGGCCCAGCCAGG + Intronic
901769393 1:11522727-11522749 GGCCCAGCCAGGGCCCAGCCAGG + Intronic
901769397 1:11522738-11522760 GGCCCAGCCAGGACCCAGCCAGG + Intronic
901769413 1:11522782-11522804 GGCCCAGCCAGAGCCCAGCCAGG + Intronic
902176987 1:14657752-14657774 CATCCCCCCAGAGCACAGCCTGG + Intronic
903323358 1:22555596-22555618 GGCCCTCCCTGGGGACAGCCAGG - Intergenic
903641742 1:24864762-24864784 GGTACACTCAGGGTAAAGCCAGG - Intergenic
903831385 1:26177438-26177460 GCTCCGCCCAGGACCCAGCCCGG + Exonic
904584054 1:31569337-31569359 GGTGGAGCCAGGGAACAGCCTGG + Intergenic
905340430 1:37274000-37274022 GGTCCACACTGGGCACTGCTGGG + Intergenic
905627374 1:39497921-39497943 GGTCCCCACAGGGCCCTGCCTGG + Intronic
906065663 1:42978592-42978614 GGGGCACCGAGGGCACGGCCTGG - Intergenic
906709425 1:47918138-47918160 GGTCCACTCAGGGCACTTCAAGG - Intronic
908356380 1:63327930-63327952 GTTCCTCCCAGGACACAGGCGGG - Intergenic
908386220 1:63644153-63644175 GGCTCAGCCAGGGCACATCCTGG - Intronic
911681357 1:100719651-100719673 GGGAAACCCAGGGCAGAGCCAGG - Intergenic
913030395 1:114897050-114897072 TGTCCTCCCAGTGCACAGGCTGG + Intronic
913317146 1:117562975-117562997 GGTTCACCGAGGTCACACCCTGG - Intergenic
913449548 1:118983825-118983847 GCGCCAGCCAGGGCACAGGCCGG - Intronic
914885584 1:151581797-151581819 GGTGCAGCCAGGGGACAGTCAGG - Exonic
915521503 1:156447571-156447593 GGTTCACCAAGGGCATAGGCAGG + Intergenic
916141936 1:161707309-161707331 GGGCCACCCAGAGCACACCAAGG - Exonic
920190507 1:204190694-204190716 GGTCCCCCGACGGCTCAGCCTGG + Exonic
920316366 1:205078202-205078224 GGTCCAAGCAGAGCACAGGCAGG + Exonic
920965755 1:210699344-210699366 GGTCAAACCTGGGCACAGCATGG + Intronic
921995567 1:221414166-221414188 AGTCAATCCATGGCACAGCCAGG - Intergenic
922709565 1:227816449-227816471 GGTCCCCCAAGTGCACAGCCAGG + Intronic
922910388 1:229210897-229210919 CCTCCACACACGGCACAGCCTGG + Intergenic
1064151843 10:12872050-12872072 GGGCCTTCCAGGGTACAGCCAGG - Intergenic
1065481814 10:26202376-26202398 GTTCTACTCAGGGCACAGTCTGG - Intronic
1066221250 10:33336969-33336991 GGTCCCCCCAGGACGCAGGCGGG - Intergenic
1067494834 10:46752502-46752524 GGTCAACCCAGTTCACAGGCAGG + Intergenic
1067599823 10:47587895-47587917 GGTCACCCCAGTTCACAGCCAGG - Intergenic
1069614432 10:69797998-69798020 GGTCCATCCAGGGAAGAGACTGG - Intergenic
1069862491 10:71480351-71480373 TGTCCTCCCAGAGTACAGCCTGG - Intronic
1069909811 10:71752114-71752136 CATCAACCCCGGGCACAGCCAGG + Intronic
1070835498 10:79444975-79444997 GCTCCAGCCCGGGCTCAGCCGGG + Intronic
1071363844 10:84878605-84878627 GACCCACCCAGGCCACAGTCAGG - Intergenic
1072422941 10:95304678-95304700 GGTCAACCCAGGGCAGGGTCAGG - Intergenic
1072787884 10:98296463-98296485 GGTCCCCACAGGGCCCAGACTGG + Intergenic
1073815569 10:107202835-107202857 GGACCACCCAGGTCACAGGTAGG - Intergenic
1075072938 10:119330995-119331017 GGTGCTCCCAGGGCAATGCCTGG - Intronic
1075235169 10:120721355-120721377 TGTTCACCCATGGCAAAGCCAGG + Intergenic
1075619959 10:123919152-123919174 GGACCACCCAGGGTCCAGTCTGG - Intronic
1076562442 10:131375987-131376009 GGCCCCCCCAGGGGACAGCAAGG - Intergenic
1076692244 10:132229835-132229857 GATCCACCCAGGCCACCGCTTGG - Intronic
1076694381 10:132240098-132240120 AGCCCCCCCAGGGCAGAGCCTGG + Intronic
1076695980 10:132247597-132247619 GGGCCAGCCTGGGCACAGGCAGG + Intronic
1076846575 10:133072202-133072224 CGTCCTCCCAGGCCATAGCCTGG + Intronic
1077140746 11:1023817-1023839 TGGCCCCGCAGGGCACAGCCCGG + Intronic
1077250576 11:1558945-1558967 GGCCCACGCTGGGCACAGGCAGG + Exonic
1077270687 11:1678211-1678233 GGCCCACCCATGGCCCAGGCTGG - Intergenic
1077300746 11:1845920-1845942 GCTCCACCCAGCGCCCAGCATGG - Intergenic
1077394445 11:2314309-2314331 GCTCCAGCCATTGCACAGCCGGG - Intronic
1077423375 11:2463188-2463210 GGTCCCCCAAGGTCACAGCCGGG - Intronic
1077474105 11:2778365-2778387 CCTCCACTCAGGACACAGCCAGG - Intronic
1081552531 11:44127316-44127338 GCTCCAAACAGGCCACAGCCCGG - Intronic
1081871450 11:46384434-46384456 GGACCACTCACGGCTCAGCCTGG + Intergenic
1082008680 11:47436047-47436069 TGTCCACACAGGGCAAGGCCTGG - Intergenic
1083146878 11:60766596-60766618 TGTCCTCACAGGGCACAGCATGG - Intronic
1083696121 11:64443843-64443865 GGTCCTCCCAAGGCACATCTCGG - Intergenic
1083877428 11:65531712-65531734 GGTCCACCCAGACCCCAACCTGG + Intronic
1083885250 11:65570343-65570365 GCCCCACCCCGGGCACAGCGAGG + Intergenic
1084149587 11:67281961-67281983 GGTCCAGCCTGGGGACAGCAGGG - Intronic
1084850230 11:71933224-71933246 GGGCCAGCCAGGGCATTGCCTGG + Intronic
1085454829 11:76659917-76659939 AGGCCACCCATGGCACTGCCTGG + Exonic
1090363291 11:126187714-126187736 GGCCCACCCAGGGCCCACCTTGG + Intergenic
1090613379 11:128492419-128492441 TGTTCTTCCAGGGCACAGCCTGG - Intronic
1091614873 12:2042720-2042742 GGACAACCCGGGGCAGAGCCTGG - Intronic
1091738708 12:2944530-2944552 GGCCCACGCAGGCCCCAGCCAGG + Intergenic
1092239098 12:6826757-6826779 GGTCCTCCCAGCCCAGAGCCGGG + Exonic
1094064976 12:26352368-26352390 GGTCCCACCTGGGGACAGCCTGG - Intronic
1096181883 12:49555738-49555760 GGTGCAGCCAGGGGACAGCAGGG - Exonic
1096911994 12:54993662-54993684 GGTCTCCCCAGGGCCCAGGCTGG + Intergenic
1098520044 12:71425117-71425139 GGTACACACAGGGCACAGAATGG - Intronic
1098658020 12:73057573-73057595 GGTCCTACCAGGCCACAGACTGG - Intergenic
1099560861 12:84173195-84173217 GGTCTAGCCACTGCACAGCCAGG + Intergenic
1101490195 12:105203111-105203133 GGTCCATCCGGAGCACAGCATGG - Intronic
1102494891 12:113312658-113312680 GGTCCACCCTGGGGAAAGACTGG - Intronic
1103481126 12:121250216-121250238 GGCCGACGCAGGGCAGAGCCAGG + Intronic
1103904639 12:124321098-124321120 CCTCCACCCAGGGCACAGAGTGG - Intergenic
1104215220 12:126727329-126727351 GCTCCCCCGTGGGCACAGCCTGG - Intergenic
1104945001 12:132411885-132411907 GGGCCGGCCAGGGCAGAGCCTGG - Intergenic
1107744377 13:43489325-43489347 GGTCCACTCAAGCCACAGCTGGG - Intronic
1113607937 13:111623613-111623635 GGCCCACCCTAGGCAGAGCCAGG + Intronic
1113808733 13:113124459-113124481 TGTCCACCCAGGGTCCAGGCCGG - Intronic
1113844532 13:113378973-113378995 GTTCCAAGCAGGGCACAGGCAGG + Intergenic
1113844553 13:113379087-113379109 GTTCCAAGCAGGGCACAGGCAGG + Intergenic
1114359787 14:21959014-21959036 TGTCCAACCAGGGCACTTCCTGG - Intergenic
1116594175 14:46819283-46819305 GGTTCACCCAGTGCACAGGCCGG - Intergenic
1118338941 14:64879287-64879309 GGGCCACCCAGCGCCCAGGCAGG - Intronic
1118595202 14:67430105-67430127 GCTCCAACCAAGGCATAGCCAGG - Intergenic
1118732824 14:68681139-68681161 GGCCCACCCAGGGAACAAACTGG - Intronic
1118859647 14:69652681-69652703 GGGCCAGCCAGGAAACAGCCAGG - Intronic
1118866945 14:69711576-69711598 GGTCAACCCAGGGCAAGCCCAGG - Exonic
1119756593 14:77124318-77124340 GGTGCTCCAAGTGCACAGCCAGG + Intronic
1121735441 14:96214617-96214639 GGTGGCCTCAGGGCACAGCCAGG + Intronic
1121908926 14:97771361-97771383 GCTCGAACCAGGGCACAGCTTGG + Intergenic
1122320507 14:100852511-100852533 AGTCCAGCCAAGGCATAGCCTGG - Intergenic
1122422082 14:101584035-101584057 GGCCGTCCCAGGGCCCAGCCCGG - Intergenic
1122628682 14:103097588-103097610 GGTCACCCCTGAGCACAGCCTGG - Intergenic
1122660345 14:103290763-103290785 TGTCCTCCCAAGGCCCAGCCAGG + Intergenic
1122772782 14:104104699-104104721 GGGCCAGCCAGGGCTGAGCCTGG + Exonic
1123480121 15:20623274-20623296 GGTGCAGGCAGGGCACAGGCAGG + Intergenic
1123637886 15:22377090-22377112 GGTGCAGGCAGGGCACAGGCAGG - Intergenic
1123765795 15:23477509-23477531 AGTCCACCCAGTGCACCACCTGG - Intergenic
1124173691 15:27402481-27402503 GGCCCACCAAGGGGTCAGCCTGG + Intronic
1124517292 15:30377274-30377296 GGTCTTCCCCGGGCACAGCTTGG + Intronic
1124725652 15:32153720-32153742 GGTCTTCCCCGGGCACAGCTTGG - Intronic
1126143376 15:45455234-45455256 AGCCCACCCAGGGCACAGCTGGG - Intergenic
1128340631 15:66820492-66820514 GCTCCACCCAGGGCCCAGTGGGG - Intergenic
1129682565 15:77666012-77666034 GGCTCCCCCAGGGCACAGCGAGG + Intronic
1130954209 15:88615415-88615437 GGACCTACCAGGACACAGCCTGG - Intergenic
1132331013 15:101012674-101012696 GGTCCTGCCAGGCCACTGCCAGG + Intronic
1132338623 15:101064455-101064477 GCACCTCCCAGGGCAGAGCCAGG - Intronic
1135564908 16:23504688-23504710 GGGCCAGACAGGGCACGGCCAGG + Intronic
1135705483 16:24671132-24671154 TGTCCACCCAGGGAGCAGGCGGG - Intergenic
1136244889 16:28969225-28969247 GGGCCTCCCATTGCACAGCCCGG + Intergenic
1136269028 16:29137705-29137727 GGTCCCCTGAGAGCACAGCCAGG + Intergenic
1138413177 16:56855484-56855506 GGTCCACCATGGCCCCAGCCTGG + Intergenic
1139420112 16:66844715-66844737 GGGCCACCCGGGGCGCAGCGCGG - Intronic
1139434148 16:66926488-66926510 CAGCCACCCAGGGCACATCCAGG + Intergenic
1139694794 16:68666369-68666391 GGTGCACCCAGGGCTCTGGCAGG + Intronic
1139853917 16:69965855-69965877 GGGCGGCCCAGGGCCCAGCCCGG - Intergenic
1139882895 16:70188768-70188790 GGGCGGCCCAGGGCCCAGCCCGG - Intergenic
1140369614 16:74406751-74406773 GGGCGGCCCAGGGCCCAGCCCGG + Intergenic
1141748830 16:85944781-85944803 CGGCCACCAAGGGCAGAGCCAGG + Intergenic
1142072334 16:88098072-88098094 GGTCCCCTGAGAGCACAGCCAGG + Intronic
1142278000 16:89133031-89133053 TGCCCACCCAGGGCCCACCCAGG - Intronic
1142623029 17:1177036-1177058 GGTATACCCAGGGCACAGGGTGG - Intronic
1144872641 17:18380529-18380551 GCCCCTCCCAGGGCCCAGCCAGG + Intronic
1145273691 17:21417863-21417885 AGTTCAGGCAGGGCACAGCCAGG + Exonic
1145311877 17:21705305-21705327 AGTTCAGGCAGGGCACAGCCAGG + Intergenic
1145798351 17:27668556-27668578 GGTCATCCCAGGGCAGAGGCTGG - Intergenic
1146321821 17:31852871-31852893 TGTCCACCCAAGGAACAGCCTGG - Exonic
1146927618 17:36755773-36755795 GGTGCACACAAGGCACTGCCAGG - Intergenic
1146938192 17:36825675-36825697 GGCCCAGCCAAGGCACAGCGCGG + Intergenic
1147258406 17:39195452-39195474 TGCCAACCCAGGGCCCAGCCTGG + Intronic
1147338611 17:39740973-39740995 GGTTCTCCCAGGTCTCAGCCCGG + Intronic
1148866738 17:50632761-50632783 GCTCCAGCCAGTGCACTGCCTGG + Intergenic
1150201379 17:63361402-63361424 GGTCCAGCCACTGCACAACCAGG + Intronic
1150314978 17:64161276-64161298 GCTTGACCCAGGGCAAAGCCAGG + Intronic
1151233924 17:72704702-72704724 GGACCCCCCAGGGAACTGCCAGG - Intronic
1151380139 17:73720097-73720119 GGACCACAGAAGGCACAGCCAGG - Intergenic
1151702744 17:75752127-75752149 GGGTCACCCAGGTCCCAGCCTGG - Intronic
1152544259 17:80992659-80992681 TGACCCCCCGGGGCACAGCCGGG + Intronic
1152577415 17:81149020-81149042 GGTGCTCCCAGGACAGAGCCTGG - Intronic
1152595750 17:81236844-81236866 GGGACACCCAGGGCAGGGCCCGG + Intronic
1152882050 17:82823223-82823245 GGTCAGGCCAGGCCACAGCCAGG - Intronic
1153833367 18:8942929-8942951 GGTGTGCCCAGGACACAGCCAGG - Intergenic
1154188625 18:12208847-12208869 GGTTCACCCAGGGATCACCCAGG + Intergenic
1154344450 18:13530726-13530748 GGTCCACCCTGGGCCCTGGCAGG - Intronic
1156220986 18:35051621-35051643 GGTCCTCAAAGTGCACAGCCAGG + Intronic
1156361999 18:36391599-36391621 GGTAAACCCAGGGCTCAGCCAGG - Intronic
1157326325 18:46671475-46671497 GGTCCACCTGGGGGAAAGCCTGG - Intronic
1157944269 18:51960929-51960951 GGTCCACCTGGGGTACAGGCAGG - Intergenic
1158275985 18:55768163-55768185 GATACACCCAGGGCAAAGTCTGG + Intergenic
1159884132 18:73888147-73888169 TGCTCAGCCAGGGCACAGCCAGG + Intergenic
1160235032 18:77078910-77078932 GGAGTGCCCAGGGCACAGCCAGG - Intronic
1160272810 18:77403390-77403412 AGGCCACCCATGGCGCAGCCCGG - Intergenic
1160527743 18:79547459-79547481 GCCCCACGCAGGCCACAGCCGGG + Intergenic
1160909305 19:1467538-1467560 GGACCCCCCAGGGACCAGCCCGG + Exonic
1161072699 19:2270543-2270565 GGTCTTCCCAGGGCGCTGCCGGG - Intronic
1161253613 19:3294322-3294344 GGTCCACCTAGGGAACAGAGTGG + Intronic
1161296116 19:3521017-3521039 GCTCTACCCAGGCCACAGCGCGG - Intronic
1161296742 19:3523952-3523974 GGCCCCCACAGGGCAGAGCCAGG + Intronic
1161326181 19:3665268-3665290 GGGCCACCCTGGGCACAGCAGGG + Intronic
1161394031 19:4035290-4035312 GGTCCATGCAGGGCCCAGGCTGG - Intronic
1161480295 19:4506989-4507011 GGGCCACCCTGGGCACTGCAGGG + Intronic
1161517174 19:4702950-4702972 GGGCCGTCCAGGGCACAGCAGGG + Intronic
1162017164 19:7852011-7852033 GGGGCTCCCAGGGCTCAGCCTGG - Intronic
1162110608 19:8397785-8397807 GGGTCAGCCAGGGCTCAGCCTGG + Intronic
1162782132 19:13011915-13011937 GGTCTCCCCAGGGCCCAGGCAGG + Intronic
1163266926 19:16227288-16227310 GGCCATCCCAGGGCCCAGCCAGG - Intronic
1163540915 19:17909653-17909675 GGCCCACCTGGGGCACAGCACGG + Intergenic
1163726912 19:18928254-18928276 CGTCCACCCAGGACACCGTCTGG + Exonic
1165070036 19:33249619-33249641 AGACCCCCCAGGGCACAGCGAGG - Intergenic
1165488137 19:36107782-36107804 GGTCCTTCCAGGACAGAGCCTGG - Intergenic
1166978639 19:46620023-46620045 GCTCCACCCTGGGCCCTGCCGGG - Intergenic
1167781269 19:51600887-51600909 GGGAGACCCAGGGCACAGCGGGG - Intergenic
1168567253 19:57435540-57435562 AGTCCACCCAGGGAAGAGCGGGG - Exonic
926888961 2:17622891-17622913 GGTCCTCCCAGTGCACAGGAGGG + Intronic
927703285 2:25281612-25281634 GATCCTCCCAGGGCCCTGCCAGG - Intronic
928164382 2:28959106-28959128 GGTCCAGGGAGGGTACAGCCAGG - Intronic
930054019 2:47238352-47238374 GGGCAACCCAGGGCACAGTTTGG - Intergenic
930702198 2:54469648-54469670 GGACCACTCTGGGCACTGCCTGG - Intronic
931906350 2:66847464-66847486 GGTCCACTCAGGGCTGAGCCTGG + Intergenic
933600570 2:84325600-84325622 AGAACACCCAGAGCACAGCCTGG + Intergenic
934518734 2:95006054-95006076 GGGCGCCTCAGGGCACAGCCTGG + Intergenic
934852539 2:97710659-97710681 GGTCCATCCAGGGCCCCTCCTGG - Intergenic
936747937 2:115602700-115602722 GGCTCACTCATGGCACAGCCTGG + Intronic
937209995 2:120262345-120262367 GGTGTCCCCAGGGCACACCCAGG + Intronic
937477754 2:122230027-122230049 GCCACACACAGGGCACAGCCAGG - Intergenic
938245937 2:129778156-129778178 GGTCCACCAAAAGCACAGCAGGG + Intergenic
939325539 2:140683586-140683608 TGTCCACCCAAGGAACAGCCTGG - Intronic
945888772 2:215406308-215406330 GGTGACCCCAGGGGACAGCCCGG + Exonic
948080752 2:235203282-235203304 GGTCCACCTGGGCCACAGCAGGG + Intergenic
948789219 2:240368762-240368784 GGGGCACCCAGGGCAGAGCCTGG + Intergenic
948854653 2:240724555-240724577 GGTTCACACTGGGCACAGCTGGG - Intronic
1172045380 20:32076402-32076424 GGATGACCCAGGGCAAAGCCTGG - Intronic
1173010409 20:39176736-39176758 AGATAACCCAGGGCACAGCCAGG - Intergenic
1175645628 20:60668497-60668519 TTTCCACAAAGGGCACAGCCTGG - Intergenic
1175818522 20:61896158-61896180 GGTGCGGCCAGGGTACAGCCAGG + Intronic
1175843797 20:62048461-62048483 GGTCCACCCTGGGGACAGGAGGG - Intronic
1175861193 20:62151299-62151321 GGAGGGCCCAGGGCACAGCCAGG - Intronic
1175962311 20:62643198-62643220 GGTCCCCCCAAGCCACGGCCAGG - Exonic
1176072877 20:63235973-63235995 GGCCCACCCTGGGGACAGCAGGG - Exonic
1176147534 20:63572151-63572173 GGTGCTCCCAGGGCAGGGCCTGG + Exonic
1176215580 20:63946187-63946209 AGACCACCCAGGGCACATCCAGG + Exonic
1176306503 21:5126295-5126317 ACTCCACTGAGGGCACAGCCTGG + Intronic
1178639939 21:34337631-34337653 GGACCTGCCAGGGAACAGCCCGG - Intergenic
1178643277 21:34363805-34363827 GCTCCAGCCAGGGCAGGGCCTGG - Intergenic
1179023656 21:37660849-37660871 GATCCAACCAAGGCACAGACGGG - Intronic
1179189340 21:39109397-39109419 TGTCCACCCTGGACACAGTCGGG - Intergenic
1179271931 21:39858271-39858293 AGTCCTCACAGGGCACTGCCTGG - Intergenic
1179426131 21:41280140-41280162 GGCCCACGCAGGACACAGGCAGG + Intronic
1179533056 21:42033126-42033148 TGTGGACACAGGGCACAGCCAGG + Intergenic
1179644897 21:42769932-42769954 GGGCCCCCCAGGGCCCAGCAAGG - Intronic
1179850556 21:44135735-44135757 ACTCCACTGAGGGCACAGCCTGG - Intronic
1179935619 21:44601984-44602006 GGTGCTCCCAGGCCATAGCCCGG + Exonic
1180041777 21:45283841-45283863 GGTCCTGGCAGGGAACAGCCTGG - Intronic
1181029778 22:20144133-20144155 TGTCCACCCAGGGCTCTCCCTGG + Intronic
1181446094 22:22976005-22976027 TTTCCAACCAGGGCACACCCTGG + Intergenic
1181460043 22:23080416-23080438 GGCCCAGCCGGGGCATAGCCTGG + Intronic
1181694500 22:24586098-24586120 GGTCCACCCAAGCCAAAGCAGGG + Exonic
1182068548 22:27447166-27447188 AGTCAGCCCAGGGCAGAGCCTGG - Intergenic
1183648867 22:39142348-39142370 ACCCCACCCAGGCCACAGCCAGG + Intronic
1184239070 22:43202315-43202337 GGTCACCCCCGGGCCCAGCCTGG - Exonic
1184245878 22:43235510-43235532 GGGCCAGGCAGGCCACAGCCAGG - Intronic
1184467639 22:44678165-44678187 GGTGCAACAAGGGCCCAGCCAGG - Intronic
1184557248 22:45240202-45240224 GGTCCACCCAGAGCCCAACGAGG + Intronic
1184599401 22:45533615-45533637 GGTCCACCATGTGCACATCCGGG - Intronic
1184907513 22:47498837-47498859 GGTCCAGCCGGGGCACAGATCGG - Intergenic
1185055726 22:48577380-48577402 GGTGCACCCCGGGATCAGCCTGG + Intronic
1185379722 22:50502861-50502883 GGGCCGCCCAGAGCACAGTCAGG - Intergenic
1185420384 22:50731497-50731519 AGCCCACCCAGCGCACAGTCAGG + Intergenic
950121579 3:10485448-10485470 GGGCAAGCCAGGGCACACCCAGG + Intronic
950524839 3:13517597-13517619 AGGCCACCCAGTGCACAACCTGG - Intergenic
951613896 3:24521660-24521682 CGGCCACCCGGGGCACAGCCAGG + Intergenic
951906906 3:27715132-27715154 GGACCTCCCAGGGTTCAGCCAGG + Intergenic
952584281 3:34872581-34872603 AGCCCAGCCAGGGCCCAGCCAGG - Intergenic
953787886 3:45924265-45924287 GGACCAGCCAAAGCACAGCCAGG - Intronic
954217087 3:49130676-49130698 GTTCTACCCAGGGCACAGCCAGG + Intronic
954306326 3:49727394-49727416 GGTCCAGGCAGGACTCAGCCCGG + Exonic
954436746 3:50500346-50500368 GCTCCACCCAGCACTCAGCCAGG + Intronic
955401048 3:58591817-58591839 TGTCTCCCCAGGGCCCAGCCTGG + Intronic
958922632 3:100123602-100123624 GGTCTACCCAGCGCACGGCCTGG - Intronic
961664232 3:128486300-128486322 CGTCCAGCCAGGGCAAACCCGGG + Exonic
968433392 4:572702-572724 GCTCCAGCCAGGGCAGTGCCAGG + Intergenic
968521453 4:1036416-1036438 GGTCAACACAGTGCCCAGCCTGG + Intergenic
968595071 4:1478029-1478051 AGTGCCCCCTGGGCACAGCCAGG + Intergenic
968830674 4:2931701-2931723 GGGCCACCCAGGGCAGGGCCAGG + Intronic
970894913 4:21091068-21091090 ATTCCACACAAGGCACAGCCAGG - Intronic
975823202 4:78292622-78292644 GGTCCACCCAGGGCACAGCCAGG - Intronic
976713704 4:88100745-88100767 GGTCCACCGAGGGCTAAGCATGG + Intronic
978885259 4:113761076-113761098 CTCCCAGCCAGGGCACAGCCCGG - Intronic
982223075 4:153141228-153141250 GCACCACCCAGGGAAAAGCCAGG - Intergenic
983984156 4:174037712-174037734 GGATCAGCCAGGGCACAGCAAGG + Intergenic
984845223 4:184102809-184102831 GGACCACCCTGAGCTCAGCCTGG + Intronic
985768797 5:1796153-1796175 GGCCCATCCTGGGCACTGCCGGG - Intergenic
989560415 5:42843878-42843900 GGACCACCCATGACACAGGCTGG + Intronic
990072477 5:51801445-51801467 GCTCCACACTGGGGACAGCCTGG + Intergenic
990237340 5:53782334-53782356 GGTCCACACATGGCAGAGTCAGG + Intergenic
991085934 5:62648402-62648424 GGGCCAGCCAGGCCACAGCTGGG - Intergenic
992953883 5:81888508-81888530 AGTCTACCCATGGCAGAGCCAGG + Intergenic
995282372 5:110350685-110350707 GGGCAACCCAGGGCCCAGCCTGG + Intronic
997422241 5:133778867-133778889 GGCCCAAGCTGGGCACAGCCTGG + Intergenic
999000965 5:147922448-147922470 AGTTCACCCACTGCACAGCCTGG - Intergenic
1001196515 5:169677962-169677984 GGTCCACCTGGAGCACAGACTGG + Intronic
1001260119 5:170221265-170221287 TGGCCACCCAGGGCAAAGCAAGG - Intergenic
1001541492 5:172542866-172542888 GGCCCACCCAGCGTGCAGCCTGG - Intergenic
1001989118 5:176101496-176101518 TGTGCACACAGGACACAGCCTGG + Intronic
1002227752 5:177736642-177736664 TGTGCACACAGGACACAGCCTGG - Intronic
1002535901 5:179875221-179875243 GGCCCACCCAGGCCACAGGGTGG - Intronic
1003494584 6:6653145-6653167 GCACCATCCAGAGCACAGCCTGG + Intronic
1007396197 6:41579058-41579080 TCTCCACCCAGGACAAAGCCTGG - Intronic
1007777644 6:44232752-44232774 CGCCACCCCAGGGCACAGCCAGG - Intronic
1007960575 6:45955403-45955425 TGTCCACGCAGGGCAATGCCTGG + Intronic
1010080251 6:71853173-71853195 GGACAACCCAGGCCCCAGCCCGG - Intergenic
1016267216 6:142246583-142246605 GGTCCATCCAGACCACAGCAGGG - Intergenic
1017076101 6:150620371-150620393 GGTCTGGCCTGGGCACAGCCTGG - Intronic
1017759521 6:157557060-157557082 GGCCTCCCCAGGACACAGCCCGG - Intronic
1018034063 6:159866811-159866833 GGTGGACCCCAGGCACAGCCAGG - Intergenic
1018289970 6:162282094-162282116 GGTCCTCACAGGCCACAGACAGG + Intronic
1019644834 7:2123553-2123575 AGTCCACCCAGGGAGCACCCAGG + Intronic
1019769892 7:2876990-2877012 AGACCAGCCGGGGCACAGCCCGG - Intergenic
1021139303 7:17004021-17004043 GTTCCACCCAGCCCACAGGCAGG + Intergenic
1023621173 7:42074669-42074691 CGTCCACCCAGGGCCCTGCCAGG + Intronic
1023828359 7:44024715-44024737 TATCCACCAAGGCCACAGCCAGG + Intergenic
1024109930 7:46134555-46134577 GTGCCACCCAGGGCACACACAGG + Intergenic
1024438101 7:49382376-49382398 AGTCCTCCCAGTGCACAGCCTGG - Intergenic
1024568743 7:50706863-50706885 TGCTCACCCAGGGCTCAGCCTGG - Intronic
1024628103 7:51225583-51225605 GTTCCTGCCAGGGCACACCCAGG - Intronic
1029038436 7:97548034-97548056 GGTCCACACTGGGCAGAGGCTGG + Intergenic
1029329116 7:99836673-99836695 GCTCCACCCAGAGCAGGGCCAGG + Intronic
1029648103 7:101870958-101870980 GGTCCATCCAAGGCACTGGCAGG - Intronic
1029756659 7:102578162-102578184 TATCCACCAAGGCCACAGCCAGG + Intronic
1033227023 7:139570486-139570508 GCTCCATGCTGGGCACAGCCGGG - Exonic
1033464370 7:141577708-141577730 ACTCCACCCAGTGCACAGGCCGG + Intronic
1033534448 7:142298984-142299006 GGGTCACCCGGGGCACAGGCAGG - Intergenic
1034396665 7:150831234-150831256 ATGCCCCCCAGGGCACAGCCAGG + Intronic
1034818702 7:154197134-154197156 CTGCCACCCACGGCACAGCCTGG + Intronic
1035129556 7:156640031-156640053 GGGCCACGCAGGGCTCACCCGGG + Exonic
1036425940 8:8645435-8645457 TGTCCACCGAGGGCACTGCAGGG - Intergenic
1037182832 8:16027940-16027962 GGGCCACCCAGGGAAGAGCAAGG - Intergenic
1037294799 8:17388814-17388836 TGTCCACCCAGGCCAAGGCCAGG + Intronic
1038611956 8:29066629-29066651 GGCCCACGCTGGGCACAGCTGGG + Intergenic
1038662818 8:29511806-29511828 GCTCCATCCAGGGCTCATCCTGG - Intergenic
1039887835 8:41665257-41665279 GGGCCACTCAGGGCAGAGCCTGG - Intronic
1039916246 8:41862423-41862445 GGTCCACCTGGGGCGCAGGCTGG - Intronic
1041800124 8:61789602-61789624 AGTCCACCCAGAGCCCAGACAGG - Intergenic
1044747172 8:95382153-95382175 GGTGCACCCAGGCCTCTGCCAGG - Intergenic
1045361684 8:101438791-101438813 GTGGCACCCAGAGCACAGCCAGG - Intergenic
1048203444 8:132396148-132396170 GGAGCACCCAGGCCACTGCCTGG - Intronic
1048964381 8:139604751-139604773 GGCCTACCCAGGGCTCATCCAGG - Intronic
1049205423 8:141361349-141361371 GGGCCATCCAGGCCAGAGCCAGG - Intronic
1049245717 8:141561264-141561286 GGGCCTCCATGGGCACAGCCAGG - Intergenic
1049279502 8:141737149-141737171 GGTGGACTCAGGGCTCAGCCAGG - Intergenic
1049286161 8:141776400-141776422 GGCCCCACGAGGGCACAGCCTGG + Intergenic
1049590930 8:143462141-143462163 GGGCCACCCAGGACACTGCCAGG + Intronic
1049685622 8:143938150-143938172 GGTCCTCTCGGGGGACAGCCTGG - Exonic
1050297427 9:4219784-4219806 GGTCCACGCAGAGCAAAGCAGGG + Intronic
1050377233 9:4985497-4985519 GGGCCCCCGAGGGCCCAGCCTGG + Exonic
1050703157 9:8364522-8364544 GCTACAGCCACGGCACAGCCAGG + Intronic
1051681733 9:19614432-19614454 GGTCCATCCAGAGCACACCAAGG + Intronic
1055458554 9:76494890-76494912 TGTCAACCCTGGGCTCAGCCTGG + Intronic
1056763607 9:89431278-89431300 GAGCCACCCGGGGCACACCCAGG + Intronic
1057722471 9:97544104-97544126 GGCCCACCCAGCACAGAGCCCGG - Intronic
1059449178 9:114359628-114359650 GGTCCTCCCAAGGCAGTGCCCGG - Exonic
1060475598 9:123984317-123984339 GGACCTTCCAGAGCACAGCCTGG + Intergenic
1060505840 9:124197915-124197937 GGTCCACAAAGAGCTCAGCCAGG - Intergenic
1061390778 9:130316042-130316064 GGACTTCCCAGGGCACAGGCTGG - Intronic
1061463334 9:130757944-130757966 GGCCCCTCCAGGGCACACCCAGG + Intronic
1061482394 9:130903496-130903518 GGGCCACCCAGCCCACAGCCAGG + Exonic
1061626914 9:131845968-131845990 GTTACACCCAAGGCCCAGCCGGG - Intergenic
1061876955 9:133548819-133548841 GGTCCACCCCCAGCACAGCTTGG + Intronic
1061930954 9:133832932-133832954 GGGCCATGCAGGTCACAGCCAGG - Intronic
1062437990 9:136555315-136555337 GGGCGGCCCAGGGCACAGCTGGG - Intergenic
1062521452 9:136959631-136959653 AGGCCACCCAGGGCTCAGGCTGG + Intergenic
1062730587 9:138106085-138106107 GGTGGAACCAGGACACAGCCTGG + Intronic
1190931106 X:54950417-54950439 GGAGCACCCAGACCACAGCCTGG + Intronic
1191945508 X:66530654-66530676 AGTCCACCCAGGGACCAGACAGG - Intergenic
1199189495 X:144953272-144953294 GGTCCACAGAGAGTACAGCCTGG - Intergenic
1199557531 X:149125303-149125325 GCTCTACCCAGAGCACACCCAGG + Intergenic
1199642869 X:149881149-149881171 CGTCCACCCAGGGCTCACCTGGG - Exonic