ID: 975829517

View in Genome Browser
Species Human (GRCh38)
Location 4:78354542-78354564
Sequence AAACCCATCAATTTTAAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 422
Summary {0: 1, 1: 0, 2: 3, 3: 33, 4: 385}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975829516_975829517 -2 Left 975829516 4:78354521-78354543 CCATACTTATCTCACAAGCAGAA 0: 1
1: 0
2: 0
3: 10
4: 166
Right 975829517 4:78354542-78354564 AAACCCATCAATTTTAAAAGTGG 0: 1
1: 0
2: 3
3: 33
4: 385
975829515_975829517 2 Left 975829515 4:78354517-78354539 CCTGCCATACTTATCTCACAAGC 0: 1
1: 0
2: 0
3: 9
4: 91
Right 975829517 4:78354542-78354564 AAACCCATCAATTTTAAAAGTGG 0: 1
1: 0
2: 3
3: 33
4: 385

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975829517 Original CRISPR AAACCCATCAATTTTAAAAG TGG Intronic
900247715 1:1645629-1645651 AAACCCAGCACTTTGAAAAGCGG - Intronic
900258942 1:1712767-1712789 AAACCCAGCACTTTGAAAAGCGG - Intronic
901044024 1:6384829-6384851 ACCTCCATCAATTTTGAAAGGGG - Intronic
901272002 1:7959418-7959440 AAAACAATCAGATTTAAAAGTGG + Intronic
903763250 1:25713983-25714005 ATACCACTCATTTTTAAAAGGGG + Intronic
904426721 1:30429741-30429763 AAATACATCAATTTACAAAGAGG + Intergenic
906451142 1:45948889-45948911 AAACCCCTGATTTTTAAAATAGG - Intronic
907625200 1:56022732-56022754 AAAGCATTCCATTTTAAAAGGGG - Intergenic
907925596 1:58952860-58952882 AAAGCATTCCATTTTAAAAGGGG + Intergenic
908183741 1:61631805-61631827 AAACATATAAATTTTAAAATGGG + Intergenic
908214491 1:61936826-61936848 AATCCCATCACTTTGAAAGGAGG - Intronic
908814058 1:68013625-68013647 AACCATATCAATTCTAAAAGAGG - Intergenic
909965854 1:81909210-81909232 AAACCCCTCAATTTTAAAAATGG - Intronic
910151930 1:84158500-84158522 AAACGACTCAATTTTGAAAGTGG - Intronic
910449769 1:87333185-87333207 AAACTCATTAATTTGAAAGGAGG + Intronic
910741345 1:90521528-90521550 AGACAAACCAATTTTAAAAGAGG + Intergenic
911332259 1:96538835-96538857 AAACCCTTCAAGTTTAGAAATGG - Intergenic
911849066 1:102791803-102791825 AACCCTATTAATTTTAAAATCGG - Intergenic
912909218 1:113740401-113740423 AAATACTTCAATTTTAAAATGGG - Intronic
916380464 1:164205049-164205071 AAAGCCCTCATTTTAAAAAGTGG - Intergenic
916929048 1:169555522-169555544 AAAGGCAAGAATTTTAAAAGGGG + Intronic
917705303 1:177627012-177627034 AAACAACTCAATTTTAAAATGGG + Intergenic
918206095 1:182310784-182310806 AAACCCATCCTTTTTGACAGTGG - Intergenic
918808488 1:189082620-189082642 GAACGCATCAAATTGAAAAGTGG + Intergenic
919374124 1:196770813-196770835 AAACCAATCATTTTAAAACGTGG - Intergenic
919383757 1:196893121-196893143 AAACCAATCATTTTAAAACGTGG - Intronic
920459812 1:206130875-206130897 TAGCCCATCAGTTTTCAAAGTGG + Intergenic
920548492 1:206838550-206838572 AAAACCATCATTTTCAAATGAGG + Intronic
920892700 1:210007558-210007580 AAATACATGAATTTTAAAACTGG - Intronic
921273598 1:213494454-213494476 AAACCCTAAAATTTTAATAGCGG + Intergenic
922184780 1:223264697-223264719 AGACCCATCAAGTTTAAATCCGG + Exonic
922243728 1:223774776-223774798 ATAGCCTTTAATTTTAAAAGTGG + Intronic
923168558 1:231391357-231391379 AAACACTAGAATTTTAAAAGTGG + Intronic
923730174 1:236542721-236542743 AAACACAACAATGTTAGAAGGGG - Intronic
924832874 1:247615742-247615764 AAACAAAAAAATTTTAAAAGTGG + Intergenic
1064805849 10:19131172-19131194 AAACCTATCATTTAAAAAAGTGG + Intronic
1067676560 10:48384630-48384652 AAACCCTTCTTTTTTAGAAGAGG - Intronic
1067860037 10:49836806-49836828 AAACAGATCAATTTTTAAAAAGG + Intronic
1067880792 10:50042949-50042971 ATACCCATCATTTTGAAATGTGG - Intergenic
1068107186 10:52633116-52633138 AATCCCATAAATTTTGAAGGAGG + Intergenic
1068558614 10:58486379-58486401 AAACCCATCAGTTGGAAAACTGG + Intergenic
1068880640 10:62045204-62045226 ACACCCATAAATTTTAGGAGTGG + Intronic
1070682752 10:78460474-78460496 ACACACATCAATTCTGAAAGAGG - Intergenic
1072490403 10:95899959-95899981 AAATATATCACTTTTAAAAGTGG + Intronic
1073651566 10:105365911-105365933 AAAACCATATATTTTAAAAAGGG - Intergenic
1074076931 10:110136795-110136817 AAACCCTTCATTTTTATAATGGG - Intergenic
1074468872 10:113708709-113708731 AAGCCCTTCATTTTTAAATGAGG - Intronic
1074580496 10:114714397-114714419 AAACACAGCCATTTAAAAAGAGG + Intergenic
1074941434 10:118239608-118239630 AAACCGCTGACTTTTAAAAGTGG + Intergenic
1077767438 11:5175652-5175674 AAACCAAACAATTTTAAAGCAGG - Intronic
1078258109 11:9678199-9678221 AAAACAATCAATTTTTAAAATGG + Intronic
1078916683 11:15784860-15784882 AGAGTCATCATTTTTAAAAGTGG + Intergenic
1078919694 11:15818072-15818094 AAACCCTTAGATTTTATAAGTGG + Intergenic
1079630743 11:22671381-22671403 AAGCCAATCACTTTTAAAAGGGG - Intronic
1079920013 11:26421474-26421496 AAGCCCATCAGTTTTAATATAGG + Intronic
1080559670 11:33451368-33451390 AATCTCAACAATTTTACAAGGGG + Intergenic
1081043914 11:38248683-38248705 AAGCTCTTCTATTTTAAAAGTGG - Intergenic
1081197256 11:40176846-40176868 AAAAAGAGCAATTTTAAAAGTGG - Intronic
1081458541 11:43249390-43249412 AAAGCCATTAATTTTTAAAGTGG - Intergenic
1082292020 11:50387453-50387475 ATTCCAATCAATATTAAAAGAGG + Intergenic
1083079882 11:60080278-60080300 CAAACCAACCATTTTAAAAGAGG + Intergenic
1086011548 11:82109794-82109816 AAACCCATGAAGTTTTAAGGGGG - Intergenic
1088286557 11:108195525-108195547 AAACCAAACAATTTTTTAAGTGG - Intronic
1089885609 11:121820621-121820643 AAATACATAAATTTTAAAAGGGG - Intergenic
1091064315 11:132494298-132494320 AAAAACATCTATTTTTAAAGAGG - Intronic
1091609595 12:1994433-1994455 CCTCCCATCAATTTTAAAATTGG - Intronic
1091856490 12:3744845-3744867 AACCCCATCAGTTTGAGAAGAGG + Intronic
1092900416 12:13054547-13054569 AAACCCAGCTAATTAAAAAGGGG - Intronic
1093271517 12:17067988-17068010 AAATCCATTAGTTTTAAAATGGG + Intergenic
1093557163 12:20490072-20490094 AAACCCATCAATTATATATATGG - Intronic
1094529940 12:31264844-31264866 CAACCCAAGAATTTTAAAAATGG + Intergenic
1095200130 12:39374168-39374190 AAACTCATCAATTATAAAGCAGG - Intronic
1095277932 12:40311714-40311736 AAAGCCATCACTTTTACAAATGG - Intronic
1095447414 12:42296106-42296128 AAACCCAGCACTTTTGGAAGTGG - Intronic
1095535939 12:43247594-43247616 AAACCCATAAAATTTGAGAGTGG + Intergenic
1095751469 12:45716845-45716867 AAAACCAGCAATATCAAAAGGGG + Intergenic
1096008656 12:48193946-48193968 AAGCACTTCAATTTTAAAATGGG + Intergenic
1096208918 12:49747144-49747166 AATCCCATATAGTTTAAAAGAGG - Intronic
1096435628 12:51589288-51589310 AACCCCACCAATTTTTAAATAGG + Intergenic
1097921594 12:65080479-65080501 AAACCAATGACTATTAAAAGTGG + Intronic
1098162760 12:67661988-67662010 CCACCCATTAAGTTTAAAAGTGG - Exonic
1098602864 12:72353817-72353839 ACACCCATCAATAGTAGAAGAGG - Intronic
1098848937 12:75571590-75571612 AAACCCATCAAATTTCAATCAGG + Intergenic
1099067359 12:77999340-77999362 AAACACATGAAATTAAAAAGTGG + Intronic
1099114483 12:78607667-78607689 AAACAGTTCAATTTTAAAATGGG + Intergenic
1099436707 12:82654642-82654664 AAATTGATCAATTTTAAAATAGG + Intergenic
1100189849 12:92178893-92178915 AAATGCATATATTTTAAAAGAGG - Intergenic
1101366088 12:104071985-104072007 AAAACTATCAATTTCAAAACGGG - Intronic
1103282698 12:119773171-119773193 AAATGCATCAATTTTAATTGTGG - Intronic
1105274838 13:18910774-18910796 TAACCCAACAATTTTTAAATTGG - Intergenic
1106440836 13:29767766-29767788 AAAGCAATCAATTTTTAAAATGG - Intronic
1106535937 13:30643036-30643058 AAACCCCTCATTTCTAATAGAGG - Intronic
1107611938 13:42123649-42123671 AAACAGTTCAATTTTAAAAATGG + Intronic
1107628926 13:42322880-42322902 AAATCCAGCAATATTAAAACCGG - Exonic
1108603625 13:52016241-52016263 AAAGCATTCCATTTTAAAAGCGG + Intronic
1108743254 13:53361251-53361273 AATTCCATCAATTGTAATAGAGG - Intergenic
1109310359 13:60685713-60685735 AAAAGCATCAATTTTTAAAATGG - Intergenic
1109526094 13:63578772-63578794 AAACCAGTAAATTTTAAAGGAGG + Intergenic
1109588970 13:64450673-64450695 AAACCCATTAACTTTATAAGAGG + Intergenic
1109647089 13:65272975-65272997 AAAAACATTATTTTTAAAAGTGG - Intergenic
1109855607 13:68123264-68123286 AAATCATTCAATTTTAGAAGAGG - Intergenic
1110756538 13:79181447-79181469 AAACCCAAACATTTTTAAAGAGG - Intergenic
1110932668 13:81242049-81242071 AAAACCTTCAATATTCAAAGTGG - Intergenic
1110977194 13:81853974-81853996 AACCCCAACAATTTCAAAATGGG + Intergenic
1111787122 13:92802817-92802839 AAAGCTATTAATTTTGAAAGTGG - Intronic
1112234066 13:97619405-97619427 AAACCTTTCAGTTTTAAAATAGG - Intergenic
1113326839 13:109290504-109290526 AGACCCATGAATTTTAACACTGG - Intergenic
1115033811 14:28832531-28832553 AAATGTATCAATTTTAAATGAGG - Intergenic
1115558901 14:34565403-34565425 AAACCCAACCATTTAAAAATGGG + Intronic
1115878714 14:37891464-37891486 AAAGCCTTCAGTTTTAAAAAGGG + Intronic
1116019797 14:39446476-39446498 AAACCCTCCCCTTTTAAAAGTGG + Intergenic
1117034377 14:51712970-51712992 AAACCCATTATTTTAAAGAGAGG + Intronic
1119350899 14:73964625-73964647 GAAACCAGCAGTTTTAAAAGAGG - Exonic
1119534148 14:75387323-75387345 AAACCAATAAATTTGAAAACAGG + Intergenic
1119581361 14:75784917-75784939 AAACATATGAATTTTAAAAAGGG - Intronic
1119652009 14:76390755-76390777 AAAACCATGAATTTTCCAAGGGG + Intronic
1120877642 14:89389479-89389501 AAACACATCAATTGAGAAAGAGG - Intronic
1120982726 14:90305076-90305098 AAACAATTCAATTTTAAAAACGG + Intronic
1121167297 14:91817303-91817325 AAACGCATACATTTTAAAAATGG - Intronic
1121810053 14:96877632-96877654 AATCCCTTAAATTTTAAAACTGG + Intronic
1124803547 15:32858864-32858886 AGATCCATCTATTTCAAAAGAGG - Intronic
1124859212 15:33421856-33421878 AAACGGATGAATTTTAAAAGAGG + Intronic
1125499992 15:40233723-40233745 AATCTCATCAATATTAGAAGTGG - Intergenic
1126525328 15:49647729-49647751 AAATCCTTCAAATATAAAAGGGG + Exonic
1127455525 15:59153007-59153029 AGAGCTATCAGTTTTAAAAGGGG - Intronic
1129953653 15:79613816-79613838 AGACCCACCAATTATAACAGTGG + Intergenic
1129999237 15:80032945-80032967 AAACTGATCATTTTGAAAAGCGG - Intergenic
1131850669 15:96540278-96540300 AAATCAAGAAATTTTAAAAGTGG - Intergenic
1132195512 15:99911810-99911832 AAATCCTTCACTTTTAAAATGGG + Intergenic
1132214447 15:100052407-100052429 AAAGCCATCAATATTAAGCGAGG + Intronic
1132369160 15:101281260-101281282 ACACCAATCAATTTCAAAAATGG + Intergenic
1133354700 16:5127359-5127381 AAACACCCCAATTTTAAAACAGG + Intergenic
1133713350 16:8423234-8423256 AATCCCCTCATTTTAAAAAGAGG + Intergenic
1134087679 16:11369560-11369582 AAACACATCAAATTAGAAAGAGG - Intronic
1134466228 16:14480493-14480515 AAACAACCCAATTTTAAAAGGGG + Intronic
1134748915 16:16610156-16610178 AAACCCATTAGTTTCAAAAATGG - Intergenic
1134996547 16:18743473-18743495 AAACCCATTAGTTTCAAAAATGG + Intergenic
1135276639 16:21118982-21119004 AAATGCATCAATTTAGAAAGGGG + Intronic
1135831997 16:25782755-25782777 AATCTCATTAATTTTAAAAGAGG - Intronic
1137452957 16:48594279-48594301 TAACCCACAAATTTTAAAACAGG - Intronic
1138021606 16:53487834-53487856 AAAACCACCAAATGTAAAAGTGG + Intronic
1138572307 16:57883839-57883861 TCACCCATGAACTTTAAAAGTGG + Exonic
1139239209 16:65373385-65373407 GAAACAGTCAATTTTAAAAGAGG - Intergenic
1139774377 16:69306553-69306575 TAACCAATCTATTTTAAAAGGGG - Exonic
1140841729 16:78845895-78845917 AAACCCATCTACCTTAAATGGGG - Intronic
1141333339 16:83132338-83132360 AAAACAATAGATTTTAAAAGAGG - Intronic
1142316602 16:89351058-89351080 GAATGCATCAATTTTAATAGCGG - Intronic
1143042749 17:4051348-4051370 AAACCCATAATTTTTAAAGGGGG + Intronic
1144887091 17:18470707-18470729 ACAACCAACAATTTTAAAGGTGG - Intergenic
1145145125 17:20473588-20473610 ACAACCAACAATTTTAAAGGTGG + Intergenic
1146353810 17:32117782-32117804 ACAACCAACAATTTTAAAGGTGG - Intergenic
1148091627 17:45025699-45025721 AAACCCTTCCATTTTATAACTGG - Intronic
1148532922 17:48412144-48412166 AAGCCTATTAATTTAAAAAGTGG + Intronic
1150348358 17:64422143-64422165 AATCCCAGCACTTTAAAAAGAGG + Intergenic
1150607050 17:66701626-66701648 AAACCCACAGATTTTAAAATGGG + Intronic
1151191993 17:72405526-72405548 AGACTCATCAGTTTTAAAATAGG - Intergenic
1152326086 17:79638382-79638404 AAAGTCAGAAATTTTAAAAGAGG + Intergenic
1153337368 18:3938509-3938531 AAACCCATCAAGTACAACAGAGG - Intronic
1153398142 18:4648870-4648892 AAAAACCTCAATTTTAAAAATGG - Intergenic
1153487475 18:5614511-5614533 AAACCCATCTCTTGTAGAAGTGG - Intronic
1153695924 18:7641687-7641709 AAAGTCTTCCATTTTAAAAGGGG - Intronic
1154396065 18:13990504-13990526 AAAACAATCAAATTTAAAAATGG + Intergenic
1154466529 18:14648032-14648054 TAACCCAACAATTTTTAAATTGG - Intergenic
1154938306 18:21084421-21084443 AAACAACTCAATTTTAAAATGGG + Intronic
1155337012 18:24774997-24775019 AAACCTACCAATTTTGAATGAGG - Intergenic
1155383320 18:25248838-25248860 AAACTAATCTATTTTAAGAGAGG + Intronic
1156655618 18:39282547-39282569 AAAGCCTGCAATATTAAAAGAGG + Intergenic
1156824432 18:41413563-41413585 AAATACATCAATTTTTAAGGTGG + Intergenic
1158057306 18:53296926-53296948 AAAACCATCTTTTTTAAAAAAGG + Intronic
1162540442 19:11292655-11292677 AAACACATGAATTTAAGAAGAGG + Intergenic
1165122766 19:33572296-33572318 AAACAACTCAATTTTAAAAATGG + Intergenic
1165609637 19:37139905-37139927 AAACAAATCAATTTAAAAACGGG + Intronic
1165639004 19:37368381-37368403 AAAATGTTCAATTTTAAAAGAGG + Intronic
1168199258 19:54802761-54802783 AAACTCATAATTTTTAAAAAGGG - Intronic
926274645 2:11394363-11394385 AAACACATCAAATATAAAAGGGG + Intergenic
927588827 2:24335236-24335258 AAAACCCTCAATTTTCAAGGTGG + Intronic
928519086 2:32070416-32070438 AAACCAAACTATTTCAAAAGAGG + Intronic
928580692 2:32704695-32704717 AAACCCATCAAGGTCAAAAAAGG - Intronic
928794510 2:35000322-35000344 AAAACAATCATTTTTAAAAATGG + Intergenic
928912480 2:36436669-36436691 ATACCCATCTATTTTAAAATTGG + Intronic
929140142 2:38659973-38659995 AATCTCATCAAGTTTACAAGAGG - Intergenic
929892374 2:45929029-45929051 AAATCCATCCCTTCTAAAAGGGG - Intronic
930213160 2:48664360-48664382 AAACCCATTTATTTCAATAGAGG - Intronic
930592859 2:53350190-53350212 AAATCCATCCATTTTCTAAGTGG - Intergenic
931369090 2:61645491-61645513 AAACAGCTCAATTTTAAAATGGG + Intergenic
932860147 2:75283003-75283025 CAACTCATTATTTTTAAAAGCGG + Intergenic
936345045 2:111669154-111669176 AAACTCAGCAATGTCAAAAGCGG - Intergenic
937385487 2:121428086-121428108 AAACTAAGGAATTTTAAAAGGGG + Intronic
937619994 2:123974167-123974189 AAACATATTAATATTAAAAGTGG + Intergenic
938233823 2:129684967-129684989 ATTCCCATCAATTGAAAAAGAGG - Intergenic
938628772 2:133141824-133141846 AAACCTAAAAATTTTAAAACAGG + Intronic
939313363 2:140513734-140513756 CAACCCCTGAAATTTAAAAGAGG + Intronic
939653787 2:144797012-144797034 ACACCCATTAATATGAAAAGAGG - Intergenic
940310142 2:152270249-152270271 AAAACCATCAGATTTAAAAATGG + Intergenic
940832391 2:158481718-158481740 AAATACGTCAATTTTAAAAAGGG - Intronic
941091938 2:161186829-161186851 AAACAAATCAATTTTGAAATGGG + Intronic
941337869 2:164267760-164267782 AAAGCATTCCATTTTAAAAGGGG + Intergenic
941515430 2:166469436-166469458 AAGCACATTTATTTTAAAAGAGG + Intronic
941966619 2:171306819-171306841 AAAACCCTCAATTTTAAAATGGG - Intergenic
942503593 2:176618228-176618250 AAACGCATTAATTTTATAATAGG - Intergenic
942623456 2:177873781-177873803 AAATGCATGAAGTTTAAAAGGGG - Intronic
942891036 2:180988535-180988557 AAATTCTTCTATTTTAAAAGGGG - Intronic
943253132 2:185556101-185556123 AAACTCTTCAAATTTAAAGGAGG + Intergenic
943394541 2:187316956-187316978 AAAACAATCACTTTCAAAAGTGG + Intergenic
943982880 2:194577591-194577613 AAACTCTTCAATTAAAAAAGTGG + Intergenic
944300425 2:198118300-198118322 GAACCCAGCAATTTTTAAGGTGG - Intronic
945342777 2:208677077-208677099 AAAACCACCCCTTTTAAAAGTGG - Intronic
945808816 2:214522795-214522817 AAAAACAACAATTTGAAAAGTGG - Intronic
948359637 2:237410954-237410976 AAACCCTCCAAATTTTAAAGTGG - Intronic
1170168800 20:13388118-13388140 AAAAGCATCCATGTTAAAAGTGG + Intergenic
1172375891 20:34440179-34440201 AGACCCATCACTTTCAGAAGTGG - Exonic
1172748666 20:37233734-37233756 AAACCCTACTATTTTAAAACAGG - Intronic
1173410536 20:42805665-42805687 AAAATCAAGAATTTTAAAAGGGG - Intronic
1173675049 20:44826180-44826202 AAATACATCAGGTTTAAAAGTGG - Intergenic
1174087443 20:48019229-48019251 AAACCCATTCATTTGCAAAGGGG + Intergenic
1174128843 20:48327741-48327763 AAACCCATTCATTTGCAAAGGGG - Intergenic
1175420857 20:58832079-58832101 AAACCAACCAATTCTGAAAGTGG + Intergenic
1176808064 21:13510562-13510584 TAACCCAACAATTTTTAAATTGG + Intergenic
1176951828 21:15056853-15056875 AATTCCATAAATTTTAAATGAGG + Intronic
1177004078 21:15649027-15649049 GAATCCATCACTTTAAAAAGAGG - Intergenic
1177685338 21:24429000-24429022 AAACACATCATTTTTAAAATTGG + Intergenic
1178088373 21:29135770-29135792 AAAACCATGGATTTTGAAAGTGG - Intronic
1183155068 22:36068533-36068555 AAACAGATCAATTTAAAAATGGG + Intergenic
1184475563 22:44719445-44719467 AAAGCCATCAAGATAAAAAGAGG - Intronic
949275331 3:2273226-2273248 AAAACCATCTATTTTAAAAATGG - Intronic
949316616 3:2763320-2763342 AAAACCACCACTTTAAAAAGTGG - Intronic
949586416 3:5443010-5443032 AAAAGCCTCAATTTTAAAATGGG - Intergenic
949768312 3:7551240-7551262 AAACTCTTCAATTTTTAATGTGG - Intronic
949982953 3:9514323-9514345 AATCCCATCAATTTTTAAATAGG + Intronic
949985801 3:9539591-9539613 AAACCCAGCAACCATAAAAGAGG + Intronic
950925775 3:16740193-16740215 AAACCACCCAATTTTAAAAAAGG - Intergenic
951284864 3:20798109-20798131 AAATCAAGGAATTTTAAAAGTGG - Intergenic
953078917 3:39597290-39597312 AAACTCATCATTCTGAAAAGTGG + Intergenic
953382353 3:42481736-42481758 AAACCTATCAAGGTTAACAGTGG + Intergenic
954736506 3:52712146-52712168 AAACCCAACAATATTAGAATAGG + Intronic
955716129 3:61832240-61832262 AAATCCAATAATTTTGAAAGTGG - Intronic
956037822 3:65114609-65114631 ATACTCATCATTTTTAGAAGAGG - Intergenic
957058582 3:75463040-75463062 AAACACCCCAATTTTAAAACAGG + Intergenic
957401209 3:79716110-79716132 AAACCAATCAATTTTTTAAGTGG + Intronic
957621428 3:82597292-82597314 AATCCCATCTAGTTAAAAAGGGG + Intergenic
957988724 3:87604380-87604402 AAACCCATCCATTCACAAAGGGG - Intergenic
959239050 3:103764884-103764906 AAAAGCATCAACTATAAAAGGGG + Intergenic
959268012 3:104168238-104168260 AAACCATTCAGTTTTAAAAGGGG - Intergenic
959346436 3:105200985-105201007 GAAGCCATCAATGTAAAAAGAGG + Intergenic
959420850 3:106126740-106126762 AAAGCCATCCATTGTAAAATAGG + Intergenic
959510133 3:107201261-107201283 AAACCCCTCACATTTAAAATAGG + Intergenic
959557939 3:107744317-107744339 AAACCTCTCACTTTTCAAAGAGG - Intronic
960755061 3:121002382-121002404 AAACCCTCAAATTTTAAAATGGG - Intronic
961294867 3:125876663-125876685 AAACACCCCAATTTTAAAACAGG - Intergenic
963265182 3:143233070-143233092 AAACACATGGATTTTAAAAATGG - Intergenic
964605453 3:158555879-158555901 AAAGCATTCAGTTTTAAAAGGGG + Intergenic
964679647 3:159323421-159323443 AAACCCACAAATTCTAAAAAAGG - Intronic
965889034 3:173487249-173487271 TAAGCCATCTATTTTTAAAGGGG + Intronic
966061483 3:175761829-175761851 AAAACCCTCAATTTTAAAAATGG - Intronic
966427514 3:179795394-179795416 AAACACATCAATATGATAAGAGG + Exonic
966503875 3:180677441-180677463 AAAACCATTATTTTTAATAGGGG + Intronic
967421261 3:189275760-189275782 AAATGCATCCATTTTAAATGAGG + Intronic
967467960 3:189829229-189829251 AGACCCAACCATCTTAAAAGAGG + Intronic
970008423 4:11431986-11432008 AAATCCCTCAATTATAAAATAGG - Intergenic
970380181 4:15499663-15499685 AAAACCCTGAATTTTTAAAGAGG + Intronic
971891935 4:32535753-32535775 AAACACACCAATTTAAAAATTGG + Intergenic
971931687 4:33091788-33091810 AAAACCTTTAATTATAAAAGAGG + Intergenic
972785432 4:42322118-42322140 AAAACAAGGAATTTTAAAAGTGG + Intergenic
972950709 4:44318829-44318851 GAATACATCAAATTTAAAAGTGG + Intronic
973005667 4:45002736-45002758 AAATTCATAAACTTTAAAAGTGG - Intergenic
973728747 4:53802896-53802918 AACCCCATCAATTGGAAGAGGGG + Intronic
974081975 4:57223437-57223459 AAAACGATTAAATTTAAAAGTGG - Intergenic
974449822 4:62039707-62039729 AAAGGCATTAATTATAAAAGGGG - Intronic
974463912 4:62228775-62228797 AAACCCATCAATATTCACTGTGG + Intergenic
974715141 4:65659727-65659749 ACACGCATACATTTTAAAAGTGG + Intronic
974720908 4:65736990-65737012 AAAGCCACCAATTTTAAGTGGGG - Intergenic
975083722 4:70311171-70311193 AAAACCATCAAAAATAAAAGAGG + Intergenic
975829517 4:78354542-78354564 AAACCCATCAATTTTAAAAGTGG + Intronic
976714181 4:88105856-88105878 AAACAATTCAATTTTAAAATGGG + Intronic
976867019 4:89741482-89741504 AAACCCAACTATTTAAAAAATGG + Intronic
976993394 4:91399059-91399081 AAACCACTTAATTTTAAAAGTGG + Intronic
977550757 4:98440671-98440693 ACACCCTTCAATTCTAAAAATGG - Intronic
977726577 4:100303313-100303335 AAACAAATGAATTTTAAAAAGGG - Intergenic
977963782 4:103118364-103118386 CAACCAATCAATCTTAAAATTGG - Intronic
978054141 4:104242120-104242142 AGACCCATCAACTCTAAAATGGG + Intergenic
979283171 4:118890373-118890395 CAACCCATGAATTTTAGATGAGG + Intronic
979776797 4:124599262-124599284 AAGCCCATAAATGTTAAAACTGG - Intergenic
980150021 4:129034112-129034134 AAACACATCAATTTGAAGGGAGG + Intronic
981016152 4:139976701-139976723 AAAACACTGAATTTTAAAAGAGG - Intronic
981363981 4:143879999-143880021 TATCCCATTAATTTTAAAATGGG - Intronic
981374706 4:144000773-144000795 TATCCCATTAATTTTAAAATGGG - Intronic
981385038 4:144120079-144120101 TATCCCATTAATTTTAAAATGGG - Intronic
981868973 4:149463413-149463435 AAACTCATCTATTTTTAAATGGG + Intergenic
982855830 4:160381642-160381664 AATCCAGTCAATATTAAAAGAGG + Intergenic
984109356 4:175593204-175593226 AAAACCATATTTTTTAAAAGAGG + Intergenic
984916331 4:184728147-184728169 AAACCCCATAATTTTAAAAATGG - Intronic
984979200 4:185261504-185261526 AAACCCATCAGTTTTCTAACTGG - Intronic
985975310 5:3415605-3415627 AAAGTCATCATTTTTTAAAGTGG - Intergenic
987039462 5:14048038-14048060 AAATCAATTAATGTTAAAAGTGG + Intergenic
987209259 5:15662327-15662349 AAACCCTTTAAATTTAAAATTGG - Intronic
987778749 5:22404228-22404250 AAACCCCTCATTTTGAATAGAGG + Intronic
988367253 5:30316764-30316786 AAAAGCTTCACTTTTAAAAGGGG - Intergenic
988737191 5:34034374-34034396 AAACACATCACTTTTATAACTGG + Intronic
989215630 5:38901812-38901834 AAACCCACCAATTTTAAATGAGG - Intronic
989451659 5:41593598-41593620 AATCCCAGCAATTTTGAAGGCGG - Intergenic
989652228 5:43704573-43704595 TAATCCCTCAATTTTAAAAAAGG + Exonic
990130622 5:52578523-52578545 AAATCAATGAATTTTAAAACAGG - Intergenic
992041858 5:72842668-72842690 AAACCCATCAGTTTGCAATGAGG - Intronic
992238896 5:74744621-74744643 AAAACCATCAATTTTATAGTTGG - Intronic
992684119 5:79182650-79182672 TAACCCAACATTTTTAAATGGGG + Intronic
994278346 5:97867445-97867467 AAACACCTCAATTTTAAAGACGG - Intergenic
994614994 5:102092827-102092849 AAAGCATTCCATTTTAAAAGGGG - Intergenic
994819909 5:104636040-104636062 AAACACATCATTTGTTAAAGTGG + Intergenic
994902353 5:105791245-105791267 CTTCCGATCAATTTTAAAAGTGG - Intergenic
994941013 5:106324302-106324324 TAACCCATCAATTCTAAACATGG - Intergenic
995739573 5:115341178-115341200 AAAACCATCAATTTAACTAGAGG - Intergenic
996156275 5:120106477-120106499 TTACCCATCAAATTTAGAAGTGG + Intergenic
997132279 5:131288916-131288938 AAAGTAATCAATTTGAAAAGTGG - Intronic
997364664 5:133318344-133318366 AAACCCATCAAGTTTTGTAGGGG - Intronic
998934674 5:147221918-147221940 AAACCTGACAATTTTAATAGGGG - Intergenic
998943909 5:147316607-147316629 AAACAAATCATTTTGAAAAGTGG + Intronic
999352655 5:150890096-150890118 AAACCAAACAATATTTAAAGAGG - Intronic
1002948749 6:1787856-1787878 AAATGCATCATTTTTCAAAGAGG + Intronic
1004475036 6:15963633-15963655 AATTCCATCACTTATAAAAGTGG - Intergenic
1006634105 6:35450104-35450126 AAACCCATCAACTTCAACACTGG - Intergenic
1008097664 6:47356235-47356257 AAACAACTCAATTTTAAAACAGG + Intergenic
1008818030 6:55592913-55592935 TAGCCCAACAATTTAAAAAGGGG - Intergenic
1011145298 6:84207978-84208000 AAATCCAACCTTTTTAAAAGTGG - Intronic
1011732602 6:90280965-90280987 AAACCTATCAGTTCTAAGAGTGG - Intronic
1011793120 6:90920383-90920405 AAATCCATCAATGTAAGAAGTGG + Intergenic
1012484485 6:99705565-99705587 AAACCAATCAATAGGAAAAGAGG + Intergenic
1012669344 6:102021565-102021587 AAACCCATTAATAATAATAGAGG + Intronic
1012788788 6:103665363-103665385 AAACACATCTATTTTTAAAATGG + Intergenic
1012822638 6:104106111-104106133 AAACAACTCAATTTTAAAAATGG - Intergenic
1012998121 6:105993536-105993558 AAACCCAGCAATCTTCCAAGTGG - Intergenic
1013036481 6:106389280-106389302 AAACACACCAATATTAAAATGGG - Intergenic
1013443612 6:110197910-110197932 GACCCCAGCAATTTTACAAGTGG - Intronic
1014337690 6:120158172-120158194 AAACACATCAACTTTATATGTGG - Intergenic
1014756974 6:125312091-125312113 AAATCCATCAAGTTTATAAAGGG + Intergenic
1015104457 6:129519897-129519919 AAACCAATGTGTTTTAAAAGTGG + Intergenic
1015938741 6:138428497-138428519 AAACCAGTCCATGTTAAAAGGGG + Intronic
1016632911 6:146252616-146252638 AAAACTAACAATTTTAAAAAAGG + Intronic
1017016325 6:150103265-150103287 AAACAACTCAATTTTAAAATGGG + Intergenic
1020512230 7:9071766-9071788 AATCCAAACAATTTTAAAAGTGG - Intergenic
1020915066 7:14183355-14183377 GAAGACATAAATTTTAAAAGGGG + Intronic
1021746705 7:23747948-23747970 AAATCAATCAATTTGAAAACAGG - Intronic
1021820827 7:24495814-24495836 AAAACCATCAATTATAGAATGGG - Intergenic
1023144287 7:37133928-37133950 AAAACAATCCAATTTAAAAGTGG + Intronic
1024499456 7:50088572-50088594 AAAACCACCAAATTTAAAAACGG + Intronic
1025272190 7:57533187-57533209 AAATCCATAAAATTTGAAAGTGG + Intergenic
1026435562 7:70394005-70394027 ACAACCAGCAGTTTTAAAAGAGG - Intronic
1026659741 7:72290153-72290175 AATCCCTTAAAATTTAAAAGTGG + Intronic
1027441192 7:78220726-78220748 AAACGCATCCATTTTTACAGAGG + Intronic
1028657140 7:93221394-93221416 AAGGCCATCAATTTTAAAAAGGG + Intronic
1029662510 7:101972352-101972374 AAACCAACCAGATTTAAAAGAGG - Intronic
1032990341 7:137387853-137387875 AAAGCCATGAATATTATAAGGGG + Intronic
1033708163 7:143908538-143908560 AAACCAATCTATTTTAAAGCAGG + Intergenic
1034021438 7:147647714-147647736 AAAAACACTAATTTTAAAAGGGG + Intronic
1034388117 7:150757830-150757852 AAACCTATTAATTTTAAAAAGGG + Intergenic
1035385184 7:158467240-158467262 AAACCCTCCAATTTTAAAAAGGG - Intronic
1035891332 8:3346853-3346875 AAACCCTAGAATTTTAAAAAGGG + Intronic
1036624729 8:10459846-10459868 AAAACAATCCAATTTAAAAGCGG + Intergenic
1038967792 8:32594920-32594942 AAACCCATCAATCTTAACAATGG - Intronic
1039002912 8:33001491-33001513 AAACCCATCAACTTTCACTGAGG - Intergenic
1040587802 8:48760053-48760075 AACCCCATCAAAATTAAAATAGG - Intergenic
1040687989 8:49899110-49899132 GAAACCCTCAATTTTATAAGGGG + Intergenic
1043767953 8:84161466-84161488 AAACAGCTCAATTTTAAAAACGG - Intergenic
1044657398 8:94562965-94562987 AAACCTATTAATTTTTAAAAAGG + Intergenic
1044657810 8:94566556-94566578 AAACCCCCCAATTTTAAAATGGG + Intergenic
1045019744 8:98031599-98031621 AAAGGCATTAATTTTAACAGTGG - Intronic
1046146170 8:110161733-110161755 AATCTCATCAATTGTAAAATTGG - Intergenic
1046215151 8:111135616-111135638 AAAGCCATCCATTTTAACTGAGG + Intergenic
1046238295 8:111456792-111456814 AAACCTATCTTTTTTAAAACTGG + Intergenic
1047577168 8:126169280-126169302 AAACCCACCAGTTGTAAAATTGG - Intergenic
1048068333 8:130995274-130995296 AAATCCATCCAGTTGAAAAGTGG + Intronic
1049943108 9:567759-567781 TAACCAATAAATTTTAAAATGGG - Intronic
1050010155 9:1177840-1177862 AAACCCAGCATTTTACAAAGAGG + Intergenic
1050660528 9:7878774-7878796 AAAACAATCATTTTTAAGAGGGG - Intronic
1050735871 9:8762614-8762636 CAGGCCATTAATTTTAAAAGAGG - Intronic
1050806910 9:9692280-9692302 ACACCAATCAAATTAAAAAGTGG - Intronic
1051910036 9:22143347-22143369 AAAACCCTCTATTTAAAAAGGGG - Intergenic
1052288916 9:26820410-26820432 AAACACAACAATTTTAAACAAGG + Intergenic
1052312614 9:27084475-27084497 AAAATCATTAATTTTAAAAATGG + Intergenic
1052637337 9:31121927-31121949 AAAGCATTCCATTTTAAAAGGGG - Intergenic
1055920854 9:81459499-81459521 AAAGCCATCAATTTTAATTTTGG + Intergenic
1057391340 9:94643616-94643638 GAGCCCAGGAATTTTAAAAGCGG + Intergenic
1058183517 9:101826474-101826496 AAAACCATCAGGTTTAAATGAGG - Intergenic
1058789190 9:108424352-108424374 AAACCACTCATTTTTATAAGGGG - Intergenic
1059059709 9:111022440-111022462 AAACTCTTCAGTTTTAAAAGAGG + Intronic
1059203767 9:112444403-112444425 AAACCCATCAATTTAAAACTAGG - Intronic
1059709548 9:116855001-116855023 AAACCCATCACTTTGGAAAAAGG + Intronic
1059816873 9:117926595-117926617 AAATCAATCACTTTTATAAGAGG + Intergenic
1059905177 9:118975680-118975702 AAACCCTACAATTTTAAAGAAGG - Intergenic
1060620904 9:125065024-125065046 AAACACATACATTTAAAAAGAGG + Intronic
1061467227 9:130791040-130791062 AAGCCCATCAAATTCCAAAGCGG + Intronic
1062701811 9:137910220-137910242 AAACAACTCAATTTTAAAATGGG - Intronic
1186564355 X:10646213-10646235 ACACCCATCAACATTTAAAGCGG - Intronic
1187806870 X:23130256-23130278 ATACTCATCAATTCCAAAAGAGG + Intergenic
1188132088 X:26448600-26448622 AAAACCATCTATTATAAAAAGGG - Intergenic
1188819655 X:34759147-34759169 CAACCAATTAATTTTAGAAGAGG + Intergenic
1189838480 X:45044527-45044549 AAAGCCATCAATGTTACCAGTGG + Intronic
1190423363 X:50308634-50308656 AAAGCCATTAGTTTTAAAGGAGG + Exonic
1190848177 X:54213648-54213670 AAATCCATAAAATTTAAAATGGG + Intronic
1191030767 X:55967850-55967872 AAACCCACAAATTTTAAAAGTGG + Intergenic
1191031493 X:55978530-55978552 AAACTCATCAAACTTAAAATGGG - Intergenic
1191155534 X:57268627-57268649 AAGCCCATCAGTGTTAACAGTGG + Intergenic
1192862574 X:75092722-75092744 AAAACAATCAAATTTAAAAATGG + Intronic
1193716562 X:84941230-84941252 AAACCCTCCAAATCTAAAAGGGG - Intergenic
1193909731 X:87288685-87288707 ATACCTATAAATTCTAAAAGAGG - Intergenic
1194096102 X:89640862-89640884 AAAGGCATCAATTTAGAAAGAGG + Intergenic
1194864059 X:99043477-99043499 AAAACCCTGAATTTTAAAAATGG - Intergenic
1195644065 X:107208449-107208471 AAACCCCTCCATTTTCAAAAAGG + Intronic
1196061091 X:111409135-111409157 ATATCCACCAATTTTAAAATAGG + Intronic
1196553140 X:117054223-117054245 AAACCCCTTAATTTTTAAAGAGG - Intergenic
1198485383 X:137082018-137082040 AAACTCATCAGTTTAAAAAAAGG - Intergenic
1199653054 X:149967115-149967137 AAAACAATCAATTTAAAAATGGG - Intergenic
1199865940 X:151850149-151850171 AAATACATTAATTTTAAAAATGG + Intergenic
1200294349 X:154903162-154903184 AAAACCATCCAGTTTAATAGCGG - Intronic
1200449108 Y:3302241-3302263 AAAGGCATCAATTTAGAAAGAGG + Intergenic
1201752042 Y:17443555-17443577 AAACCAACAAATTTCAAAAGAGG - Intergenic
1201858262 Y:18568932-18568954 TGACCCATAAACTTTAAAAGAGG + Intronic
1201875059 Y:18751449-18751471 TGACCCATAAACTTTAAAAGAGG - Intronic
1201980745 Y:19907714-19907736 AAACTTCTAAATTTTAAAAGTGG - Intergenic
1202168777 Y:22019133-22019155 TGACCCATGAATTTTAAAAGAGG - Intergenic
1202222584 Y:22567235-22567257 TGACCCATGAATTTTAAAAGAGG + Intergenic
1202320531 Y:23628425-23628447 TGACCCATGAATTTTAAAAGAGG - Intergenic
1202550236 Y:26041631-26041653 TGACCCATGAATTTTAAAAGAGG + Intergenic