ID: 975829964

View in Genome Browser
Species Human (GRCh38)
Location 4:78358889-78358911
Sequence CTGATGATATTGAGTAAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 318
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 295}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975829962_975829964 -2 Left 975829962 4:78358868-78358890 CCCTAATGACATGTGGGAATGCT 0: 1
1: 0
2: 0
3: 9
4: 138
Right 975829964 4:78358889-78358911 CTGATGATATTGAGTAAAAAAGG 0: 1
1: 0
2: 1
3: 21
4: 295
975829963_975829964 -3 Left 975829963 4:78358869-78358891 CCTAATGACATGTGGGAATGCTG 0: 1
1: 0
2: 0
3: 22
4: 178
Right 975829964 4:78358889-78358911 CTGATGATATTGAGTAAAAAAGG 0: 1
1: 0
2: 1
3: 21
4: 295

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975829964 Original CRISPR CTGATGATATTGAGTAAAAA AGG Intronic
901620224 1:10579148-10579170 CTGCTAATATTAAATAAAAAGGG + Intronic
907090428 1:51719407-51719429 CTGATGATACTGATTAATAGAGG + Intronic
907127206 1:52061523-52061545 TTCATGAGATAGAGTAAAAAGGG + Intronic
907932054 1:59009655-59009677 CTGAGGATAATAAGAAAAAAGGG + Intergenic
908507098 1:64814859-64814881 CTGATGATACTCAGAAAAATTGG + Intronic
909125233 1:71659832-71659854 CTGATGATGTTGTGGAGAAAAGG + Intronic
909681061 1:78292837-78292859 CTGAATATATTGAGTTAACATGG + Intergenic
912916897 1:113824528-113824550 CTAATAATACTTAGTAAAAATGG + Intronic
913132360 1:115852569-115852591 CTGATGATGATGTGGAAAAAGGG - Intergenic
914816124 1:151063929-151063951 CTGATGATAATGAGAGCAAATGG - Intronic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
917947219 1:179987075-179987097 TTTATTATATTGAGTCAAAATGG - Intronic
918036392 1:180876851-180876873 TTGATGATATTAAATAAAAGTGG - Intronic
918266786 1:182849991-182850013 CTGATGAAATTAAAAAAAAAAGG - Intronic
919270151 1:195331200-195331222 CTAATGTTATTCAGTAAAGAAGG + Intergenic
920849261 1:209617648-209617670 CTGATGAGTTGGAGAAAAAATGG - Intronic
921372732 1:214441504-214441526 ATGCTGATATTCAGGAAAAAAGG + Intronic
921416519 1:214894377-214894399 CTGATGATAATGGGAAAAACTGG - Intergenic
922646058 1:227288193-227288215 CTGAGGATATTGGGAAATAATGG - Intronic
922869273 1:228887650-228887672 ATAATGATATTTAGAAAAAATGG - Intergenic
922877674 1:228952990-228953012 CTGGTGATATTGTGGAGAAAGGG - Intergenic
923346805 1:233061590-233061612 CAGATGGTCTTGAATAAAAATGG + Intronic
924280211 1:242429646-242429668 CTCATGATAAGAAGTAAAAATGG - Intronic
924498242 1:244611067-244611089 CTAATGATATTAAATAAAATAGG - Intronic
1063599534 10:7467611-7467633 ATCATAATGTTGAGTAAAAAAGG - Intergenic
1063794509 10:9496943-9496965 CTGTTGGGATTGGGTAAAAATGG + Intergenic
1067660120 10:48230601-48230623 GTGATTATCTTTAGTAAAAATGG + Intronic
1068173639 10:53427570-53427592 CTGATTATATTTAGTGATAAGGG - Intergenic
1068302694 10:55164769-55164791 CTGATGAAACTGAATCAAAATGG + Intronic
1068801478 10:61145447-61145469 CTGAATAAAATGAGTAAAAAGGG + Intergenic
1069211288 10:65762683-65762705 CTGAAGATATTAAGAAAAGAAGG - Intergenic
1069234552 10:66054361-66054383 CTGATGAGAATGTGGAAAAAGGG - Intronic
1071022564 10:81075484-81075506 CTGATTCTATAGAGTTAAAAAGG - Intergenic
1071095547 10:81969865-81969887 ATGAAGAGATTGAGTTAAAACGG - Intronic
1072168735 10:92839379-92839401 TTGATAATACTGAGTAAAACAGG - Intronic
1073192085 10:101658750-101658772 CTAATGAGAATGAGTAAAAAAGG - Intronic
1073722328 10:106186980-106187002 CTGATGCTGTTGGGTAAAAATGG - Intergenic
1073812769 10:107168733-107168755 CAGATGATATTAAGTAACTAGGG + Intergenic
1073941286 10:108701319-108701341 GTGATGATAATGGGTAATAAAGG + Intergenic
1074265022 10:111893272-111893294 CTCATGATATTGAATAAGTATGG - Intergenic
1075237903 10:120748049-120748071 CTGATGATGTTTTGTAAAAAGGG - Intergenic
1076537920 10:131194744-131194766 CTGATGCTGTTGAGAAAACAGGG - Intronic
1078643778 11:13119545-13119567 CTGTTGTTATTGAGAAAATAGGG - Intergenic
1081004332 11:37715737-37715759 CTGATCATATCAAATAAAAAGGG + Intergenic
1081112326 11:39151523-39151545 ATAATAATATTGAGTATAAATGG + Intergenic
1081409871 11:42745424-42745446 CTGATGAAGTGGACTAAAAATGG - Intergenic
1082249673 11:49964301-49964323 CTGGTGATACTGAGGAAAACAGG + Intergenic
1082271323 11:50172332-50172354 CTCAAGACATTAAGTAAAAAAGG - Intergenic
1085914184 11:80865020-80865042 CTGATGAGATTGTGGAGAAAAGG + Intergenic
1086026891 11:82304720-82304742 CTGTTGAGATTAAGTAAAATTGG - Intergenic
1086071484 11:82804318-82804340 TTGATGATATTGAGGAATTATGG + Intergenic
1086582614 11:88416612-88416634 CTCATGATATTGACAAACAAAGG - Intergenic
1086815333 11:91363463-91363485 CTGATTATATTTAGTACCAATGG + Intergenic
1087577370 11:100006238-100006260 CTGATGCTATTGACTGATAAGGG + Intronic
1088069887 11:105769382-105769404 CAGATGATGTGGAGGAAAAAGGG + Intronic
1088525996 11:110755809-110755831 CTGAATATTTTGAGTAAATAAGG + Intergenic
1088950539 11:114565301-114565323 CAGATGGTTTTGTGTAAAAAGGG - Intergenic
1090392893 11:126400961-126400983 CTGATAATATTTAGTAACCATGG + Intronic
1092360235 12:7830450-7830472 CTGATAATAGAAAGTAAAAAAGG - Intronic
1092934702 12:13349894-13349916 AAGATGCTATTGAGTAAAAGGGG + Intergenic
1093140346 12:15502962-15502984 CTCATGCTATTAAGTAAAATAGG - Intronic
1094325565 12:29234316-29234338 CTGATGATATTGACTAGGAAAGG - Intronic
1096214185 12:49790648-49790670 ATGATGATATTAACTAAGAAGGG + Intergenic
1097363336 12:58682263-58682285 TTGATGTTATTGAGAAAACAAGG + Intronic
1097487124 12:60217191-60217213 CACAAGATAATGAGTAAAAAGGG + Intergenic
1097808172 12:63988403-63988425 CTGATGGTGTTAAGAAAAAAGGG + Intronic
1100116610 12:91313195-91313217 ATGATGCTATTTAATAAAAATGG + Intergenic
1101711757 12:107273987-107274009 CTGAAGATATTGAGGATATAAGG - Intergenic
1105269815 13:18862027-18862049 CCTATGAGATTGAGTAAAAATGG + Intergenic
1105961235 13:25342622-25342644 AGAATAATATTGAGTAAAAAAGG + Intronic
1106604926 13:31219886-31219908 TTGATGATAATGATGAAAAAAGG + Intronic
1106998424 13:35515659-35515681 CTGAGGACATTGTGTTAAAAAGG + Intronic
1107386496 13:39915503-39915525 GTAATGATAGTGAGTAAGAATGG - Intergenic
1110266611 13:73544534-73544556 CTGATGATAAAGAGGAAAAGAGG - Intergenic
1110438318 13:75499638-75499660 CTCATTATATTGAGTAGAAGAGG + Intergenic
1110482044 13:75990067-75990089 CTGGTGATATTGTGGAGAAAAGG + Intergenic
1111807954 13:93061614-93061636 CTGATGATTTTGAGGGAGAAGGG + Intergenic
1113239334 13:108318872-108318894 CTGGTGAGATTGAGGAGAAAAGG - Intergenic
1113334014 13:109360823-109360845 CTGTTGATTTTGGGAAAAAAGGG + Intergenic
1113726247 13:112604810-112604832 GATATGATATTGAGTGAAAAGGG - Intergenic
1115012163 14:28562053-28562075 CTGAAGACAGTGAGGAAAAAGGG + Intergenic
1116272502 14:42789519-42789541 CTGATGATAATGAATTAGAATGG - Intergenic
1117100968 14:52346951-52346973 CTCATGATATTTCGTATAAATGG - Intergenic
1118712447 14:68533020-68533042 AGAATGATATTGAGTAATAAGGG - Intronic
1119965099 14:78906143-78906165 TTTATGATACTTAGTAAAAATGG + Intronic
1122335624 14:100978035-100978057 CTGAGGATATTTAGTAAAGGAGG - Intergenic
1202829541 14_GL000009v2_random:11948-11970 CCTATGAGATTGAGTAAAAATGG - Intergenic
1124063819 15:26320995-26321017 CTGAAGATAAAGATTAAAAATGG + Intergenic
1124821242 15:33047643-33047665 CTGATGATTTTGAGTTATCAAGG + Intronic
1124850415 15:33332318-33332340 CTGAAAATATAGAGCAAAAATGG + Intronic
1125355783 15:38816245-38816267 CCGATGAAATTGACTGAAAATGG - Intergenic
1127003474 15:54538352-54538374 CTGATGAGGTTGTGTAGAAAAGG + Intronic
1129637277 15:77333766-77333788 CATATGATATTGACTAAGAATGG - Intronic
1131815864 15:96220548-96220570 TAGATGACATTGAGTGAAAAAGG - Intergenic
1131859337 15:96636008-96636030 CTGATGATTTTGAGATAAACTGG + Intergenic
1132064558 15:98719910-98719932 CTGATGAAAATGTGTAAGAAGGG + Intronic
1133657231 16:7877630-7877652 CTAATGATTCTGAGTAGAAATGG + Intergenic
1135542150 16:23338625-23338647 CTAATGAAAATGAGTAAAGAGGG + Intronic
1139186367 16:64810484-64810506 TTGATGATACTGAGTGAGAATGG - Intergenic
1140419917 16:74810642-74810664 GTCATGATTTTTAGTAAAAATGG + Intergenic
1141125578 16:81398326-81398348 CTGGTGATATTGAGGAAATGAGG - Intergenic
1141474328 16:84262417-84262439 TTGATGATATTGAGCTGAAATGG - Intergenic
1144926800 17:18818243-18818265 CTGTTAACATTGAGTAAAACAGG - Intergenic
1145724528 17:27105881-27105903 CTGATGAAACTGAATCAAAATGG - Intergenic
1146726129 17:35157656-35157678 CTGATGAGAATGTGTTAAAATGG - Intronic
1149962669 17:61129147-61129169 CTGAGGGTATGGAGTAAGAAAGG + Intronic
1150865239 17:68842222-68842244 CAGTTGATATTAAGTAAAAGAGG - Intergenic
1150972310 17:70042724-70042746 CTGAAGATATGGAGAAAAAGGGG - Intergenic
1153591785 18:6682204-6682226 CTGATGATTTTGTGTAAACAGGG - Intergenic
1154385012 18:13885250-13885272 CTGATCATATTGAGAAACATGGG - Exonic
1155021064 18:21897385-21897407 ATCATGATACTGAGTAAATATGG + Intergenic
1155084922 18:22448739-22448761 CTGATGAGGTTGAGGAGAAAAGG + Intergenic
1156090979 18:33468833-33468855 CTGATCATATTGGATCAAAAAGG - Intergenic
1156857619 18:41800788-41800810 CTACTGATATTACGTAAAAATGG - Intergenic
1158677387 18:59532864-59532886 TTGATGGGATTCAGTAAAAAAGG - Intronic
1159611520 18:70531046-70531068 CTGATGCTATAGAAAAAAAATGG - Intergenic
1159657572 18:71050951-71050973 GAGATGCTATTGAGTACAAATGG + Intergenic
1159705813 18:71685662-71685684 GTGAAGAAATTGAGTAGAAATGG - Intergenic
1159952275 18:74493691-74493713 CTGATGATTTTGAGGACAACAGG - Intergenic
1160447575 18:78939601-78939623 CTCGTGATATTGAGTGAAACAGG + Intergenic
1166867149 19:45846360-45846382 CTGATACTATTAAGTCAAAAAGG + Intronic
1167407216 19:49319825-49319847 CTAATTCTATTGAGAAAAAAAGG - Intronic
1202643153 1_KI270706v1_random:115833-115855 CCTATGAGATTGAGTAAAAATGG + Intergenic
927735935 2:25522235-25522257 GTGAGAATATTGAGTAAACAAGG - Intronic
928504994 2:31941911-31941933 ATTCTGATATTGATTAAAAACGG + Intronic
929354967 2:41011554-41011576 CAGAAGAAATTGAGTAGAAAAGG + Intergenic
929532056 2:42759220-42759242 CTGCTGAGATGGAGGAAAAATGG - Intergenic
929986747 2:46741670-46741692 TTCATGATATTAAATAAAAATGG - Intronic
931003916 2:57826218-57826240 CTGATGATTTTTTTTAAAAAAGG + Intergenic
931094856 2:58927705-58927727 CCAATAATATTGAATAAAAATGG - Intergenic
931165289 2:59740665-59740687 CTGAAGATGATGAGTAAATATGG + Intergenic
931258054 2:60591377-60591399 CTGAAGAGTTTGAGTAAAATTGG - Intergenic
931312820 2:61098461-61098483 GTTATGTTGTTGAGTAAAAAAGG - Intronic
932043739 2:68326248-68326270 CTAATGATATTGTGTGAATATGG + Intergenic
932071266 2:68622683-68622705 CTGGGGATATTTAATAAAAAAGG + Intronic
932244128 2:70182059-70182081 CTTATGATATTTAGTACAGAAGG + Intronic
932861778 2:75300854-75300876 CTTATAATGTTTAGTAAAAAAGG - Intergenic
933116984 2:78486236-78486258 TTGATGATATTCAGTAAATGTGG + Intergenic
933138266 2:78762292-78762314 CTGATGATAAGGAGAAAAACTGG - Intergenic
933361895 2:81297448-81297470 CTGATAAGTTTGGGTAAAAATGG - Intergenic
934665450 2:96166271-96166293 ATGACACTATTGAGTAAAAACGG + Intergenic
937564977 2:123274444-123274466 TTGAGGATACTGAGTCAAAAAGG + Intergenic
938718545 2:134043608-134043630 CTGCTGATACTGAGGCAAAAAGG + Intergenic
939113661 2:138036735-138036757 CTGATGATGTTAAGCAAAGAAGG - Intergenic
940231804 2:151462289-151462311 CTGACTATACTGAGTAAATAAGG - Exonic
940506234 2:154557075-154557097 CAGAATATTTTGAGTAAAAAGGG + Intergenic
940754640 2:157668227-157668249 CTGAGGATATGGAGTAAAAAAGG - Intergenic
941094633 2:161223523-161223545 CTTTTGATATTCAGTAAAAATGG - Intronic
942022504 2:171880860-171880882 CAAATAATATTAAGTAAAAAAGG + Intronic
942674108 2:178408907-178408929 TTGATGATAGATAGTAAAAAAGG - Intergenic
942875253 2:180787953-180787975 ATAATCATACTGAGTAAAAAAGG + Intergenic
943609672 2:190017262-190017284 TTGATGATTTTGAATATAAATGG - Intronic
944979319 2:205096476-205096498 CTGATTATATTGATTATCAATGG + Intronic
945691573 2:213043533-213043555 CTGCTGATATAGAGTATTAAGGG - Intronic
946630337 2:221660336-221660358 CTGATGGGATTGAGTATAGAGGG - Intergenic
947095001 2:226556242-226556264 CAGATGACATTGTGGAAAAAGGG + Intergenic
1169740299 20:8886240-8886262 CTGATGAGAATGAGGAGAAAAGG - Intronic
1171193245 20:23176666-23176688 TTGAAGATATTGTGAAAAAATGG - Intergenic
1171890271 20:30706037-30706059 CCTATGAGATTGAGTAAAAATGG + Intergenic
1172925069 20:38526483-38526505 CTGATGTGTTTGAGAAAAAAAGG - Intronic
1175743879 20:61439873-61439895 ATGGTGATATTGGGGAAAAAAGG + Intronic
1176608726 21:8856790-8856812 CCTATGAGATTGAGTAAAAATGG - Intergenic
1177270562 21:18843862-18843884 GTGGATATATTGAGTAAAAAAGG + Intergenic
1178451095 21:32700837-32700859 CTGATGATGTTGATGACAAATGG + Intronic
1179526627 21:41981777-41981799 CCGATGATATGTAGTTAAAATGG - Intergenic
1180358813 22:11866608-11866630 CCTATGAGATTGAGTAAAAATGG - Intergenic
949488552 3:4565062-4565084 CAGATGTTATTAAATAAAAAAGG - Intronic
949847569 3:8387352-8387374 CTGAAGATATTTAATAAGAATGG + Intergenic
950728390 3:14934784-14934806 ATGATGATATAAAGTAAAAGAGG - Intergenic
952591142 3:34955571-34955593 CTGATGATAGAAAGGAAAAATGG + Intergenic
955895450 3:63694763-63694785 CTGGTGATACTGAGGCAAAAAGG + Intergenic
956297776 3:67733146-67733168 CTGAGTATATTGAGGAAAATTGG + Intergenic
956391819 3:68781453-68781475 CTGATTATATTGATAATAAAAGG + Intronic
956554471 3:70503302-70503324 CTGATGAGGTTGAGGAGAAAAGG + Intergenic
956987031 3:74712500-74712522 CAGAAGATATTGATTGAAAAAGG - Intergenic
957229097 3:77488670-77488692 GAGATGATTTTGAGTCAAAAGGG + Intronic
957366783 3:79235120-79235142 CTAATTATATTGAGAATAAAGGG + Intronic
958750095 3:98185475-98185497 GTTATAATATTGAGTATAAAGGG + Intronic
959482752 3:106893500-106893522 CTGGTGAGATTGGGTAGAAAAGG + Intergenic
960463895 3:117971405-117971427 CTGAAAATATTGAATAAAATTGG - Intergenic
960638397 3:119806184-119806206 CTGAGGATGTTCAGTAGAAATGG - Intronic
961020495 3:123502225-123502247 GTGATGATATGGACAAAAAAGGG + Intronic
962936540 3:140086401-140086423 ATGAAGATATTGAGTCACAAAGG - Intronic
963800246 3:149669032-149669054 TTGGTGATTTTGGGTAAAAAAGG - Intronic
963922889 3:150923021-150923043 CTGATGAAATTTTGTAACAAAGG - Intronic
964333440 3:155629182-155629204 CTGATGTCATTCAGAAAAAATGG - Intronic
964711638 3:159677326-159677348 CTGTTGATGTTGAGTATGAATGG + Intronic
965449669 3:168822010-168822032 CTGACAAGATTCAGTAAAAAAGG - Intergenic
966164259 3:176999412-176999434 CTGAGGATATAGAGGCAAAAAGG + Intergenic
966962948 3:184958858-184958880 CTGATTATTTTTGGTAAAAATGG - Intronic
967092743 3:186149251-186149273 GTCATAATATTGTGTAAAAAGGG - Exonic
967709641 3:192690840-192690862 CTGAAGATATTTAGTGCAAATGG + Intronic
970202089 4:13620327-13620349 TAGATGATTTGGAGTAAAAAAGG + Intronic
971271177 4:25147522-25147544 CTGATTATTTTGAGTCACAATGG - Intronic
971928488 4:33047091-33047113 CCCCTGATATTGAATAAAAATGG + Intergenic
972092107 4:35300215-35300237 CAGATAATATTGAGTAATACTGG + Intergenic
972384595 4:38552829-38552851 ATGAGGGTATTGAGTCAAAATGG + Intergenic
974805333 4:66872321-66872343 CTGAGGATATTGATTATACATGG + Intergenic
975158436 4:71097658-71097680 CTGATGAAATTGCGGAGAAAAGG - Intergenic
975426989 4:74241366-74241388 ATAATGATATTGGGGAAAAATGG - Intronic
975593942 4:76029084-76029106 CTAAAGATTTTGATTAAAAATGG - Intronic
975829964 4:78358889-78358911 CTGATGATATTGAGTAAAAAAGG + Intronic
978605878 4:110478548-110478570 CTCAAGACATTAAGTAAAAAAGG - Intronic
978667675 4:111205248-111205270 CTAACAATATTGAGTTAAAAAGG + Intergenic
978950912 4:114558014-114558036 ATGATGATACTGATTAAAATTGG - Intergenic
980132346 4:128828549-128828571 CTGAAGATCTTGAGTAATGAGGG - Intronic
980721490 4:136701939-136701961 GTGATCAGATTGAGAAAAAAAGG - Intergenic
982524140 4:156456365-156456387 CTGGTGAGGTTGAGGAAAAAAGG + Intergenic
982819147 4:159924789-159924811 CTGATGATTTTGAGCAAAGAAGG + Intergenic
984687452 4:182686795-182686817 TTGATTAGATTGAATAAAAAGGG + Intronic
985124799 4:186682777-186682799 CTGATGACATGGAGAAAAGAAGG - Intronic
985339802 4:188938523-188938545 CTGATTATTTTGGGTAGAAATGG + Intergenic
985343731 4:188978599-188978621 TTGGTGATATTGAGTGGAAATGG - Intergenic
1202770525 4_GL000008v2_random:201743-201765 CCTATGAGATTGAGTAAAAATGG + Intergenic
985966902 5:3344586-3344608 GTGATGAAAGTGTGTAAAAAAGG + Intergenic
986320022 5:6623118-6623140 CTAATTATATTAAGAAAAAATGG + Intronic
986532325 5:8751389-8751411 CTGATGAGATTGTGGATAAAAGG + Intergenic
986537317 5:8804327-8804349 CTGAGGATTTTAATTAAAAAGGG - Intergenic
986888480 5:12270268-12270290 CTGAAAGTATTGAGGAAAAAGGG + Intergenic
988452133 5:31353918-31353940 CTGATGCTATGGTGTCAAAAGGG - Intergenic
990636154 5:57730008-57730030 CTATAGATATTGAGTAAAAAGGG + Intergenic
991349190 5:65703143-65703165 ATGATAATATTGAAAAAAAATGG + Intronic
992364729 5:76080330-76080352 CTGATGATAGTGAGGAGAAGTGG + Intergenic
992837817 5:80657607-80657629 CTGAGGATAATGAATAAAGATGG - Intronic
993699511 5:91101350-91101372 TTGATGATAGTGGGTAAAGAAGG + Intronic
994823920 5:104688227-104688249 CTAAATATATTGAGCAAAAATGG - Intergenic
995010083 5:107247725-107247747 CTGATGATATTAGGGAAAAGTGG + Intergenic
995116052 5:108480910-108480932 CTGATGATAATGAATATAATCGG - Intergenic
995496947 5:112756183-112756205 GTGATGATACTGAATATAAAGGG - Intronic
995834831 5:116389512-116389534 CTGAAAATATTTATTAAAAATGG + Intronic
996390964 5:122961163-122961185 CTGATGAAACTGAGTAAAGTTGG + Intronic
998614960 5:143729964-143729986 GAGATGATATTGAGAAAAATGGG - Intergenic
1000107541 5:158074650-158074672 CAGATGATATTGATTCCAAATGG - Intergenic
1000287847 5:159843080-159843102 CTGAGGATATTGAGGGACAACGG + Intergenic
1000473834 5:161680080-161680102 TTAATGATATTGAGCCAAAAAGG - Intronic
1000695679 5:164378803-164378825 CTGATGAGACTGTGAAAAAAGGG - Intergenic
1001985405 5:176070470-176070492 CCTATGAGATTGACTAAAAATGG - Intronic
1003727182 6:8778089-8778111 CTGATAATATTAAATAAACAAGG - Intergenic
1003771328 6:9305483-9305505 ATGATGATAATGAGTAAAAGAGG - Intergenic
1003920804 6:10831130-10831152 TAGATTATATTTAGTAAAAAAGG - Intronic
1005862562 6:29912698-29912720 TTGATGATAAAGAGAAAAAAAGG - Intergenic
1007219097 6:40264504-40264526 CTGATTTTATAGAGTAGAAAGGG + Intergenic
1008373749 6:50767628-50767650 TTGATGATACTGATGAAAAAGGG - Intronic
1008429297 6:51396804-51396826 GTAATGAGATTGAGTACAAAAGG - Intergenic
1008826896 6:55706442-55706464 CTCTTGATAATGAGTAAAATTGG + Intergenic
1010848636 6:80744581-80744603 CTGATGTAATTGAGTCAAACTGG - Intergenic
1010880565 6:81164173-81164195 GTGGGGATATTGAGTGAAAAGGG - Intergenic
1011599045 6:89042973-89042995 CTGATCATAGTGGGTTAAAATGG + Intergenic
1011781285 6:90792304-90792326 CTGAGGATAATGGGAAAAAATGG + Intergenic
1012678260 6:102144403-102144425 ATGAGGATATTGAGTCACAAAGG + Intergenic
1014579882 6:123123924-123123946 TTGATGAGATTTAGTAAAGATGG + Intergenic
1014727896 6:124994965-124994987 CTACTAATATTGTGTAAAAATGG + Intronic
1014836727 6:126168276-126168298 TCGTTGATACTGAGTAAAAAGGG + Intergenic
1015155328 6:130088580-130088602 CAGATGACATTGAAGAAAAATGG + Intronic
1016687883 6:146901742-146901764 CTTCTGAAATTGAGTAAGAAAGG - Intergenic
1017266996 6:152458757-152458779 CTGATGTTTTTGTTTAAAAAGGG + Exonic
1017398892 6:154036628-154036650 CAGACTATATTGAGTCAAAAAGG + Intronic
1018046986 6:159974228-159974250 CTCATGATGTTGAGCAAGAAAGG + Intronic
1019353778 7:568535-568557 CTGATGATGTTGAGTGAAGCCGG - Intronic
1020835234 7:13141280-13141302 TTGATGATAGTGAAAAAAAAAGG - Intergenic
1021156098 7:17212106-17212128 CTGATGATAGTGAGGTAGAAAGG + Intergenic
1021585251 7:22201037-22201059 TTGATGAAACTGAGCAAAAATGG + Intronic
1023141870 7:37109921-37109943 CTGATGATATGAACTGAAAAGGG + Intronic
1023368111 7:39485296-39485318 CTGACTCTCTTGAGTAAAAAGGG + Intronic
1023617405 7:42034157-42034179 CTGATGATATTTTGAAGAAACGG - Intronic
1023634221 7:42193671-42193693 CAGGTAATATTGAGTTAAAAAGG - Intronic
1024371874 7:48594844-48594866 CTGATAAGACTGAGTAACAAAGG + Intronic
1027209571 7:76134520-76134542 CTGATGCTATTCAGTACCAAAGG + Intergenic
1027736763 7:81942222-81942244 CTGGTTATATTGAAAAAAAAAGG - Intergenic
1028009253 7:85619731-85619753 CAGATGATATTGAGTTAATCTGG - Intergenic
1029064549 7:97836393-97836415 CTGATCATATTGGCTAAAACTGG - Intergenic
1030408898 7:109149243-109149265 CTGGTGAGAATGAGGAAAAAGGG - Intergenic
1034001481 7:147417688-147417710 CTGATGATGGTGAGTTTAAATGG + Intronic
1036654495 8:10668864-10668886 ATGATGATAGAGAATAAAAAGGG + Intronic
1038080374 8:24128274-24128296 CTGAAGATATTAAGAAACAAGGG + Intergenic
1039932926 8:42011104-42011126 CTGAAGCCCTTGAGTAAAAAGGG - Intronic
1041412009 8:57566681-57566703 ATGCTGATATAGTGTAAAAAAGG + Intergenic
1043501090 8:80857258-80857280 AAGATGATATTGAATAAAACAGG + Intronic
1044039773 8:87353184-87353206 CCGATGGTATTAAGTCAAAAAGG - Intronic
1044437529 8:92182695-92182717 CTGAATATATTTAGTAAAATTGG + Intergenic
1045511634 8:102816213-102816235 ATGAAGATGTTGAGGAAAAAAGG + Intergenic
1046373257 8:113340295-113340317 CTGATGATGTGGAGTTAAAATGG - Intronic
1046940118 8:119922804-119922826 CTGAGGATAATGAGAAAAACGGG - Intronic
1047343248 8:124002766-124002788 TTCATGATATTTAGTGAAAAAGG + Intronic
1047359090 8:124151629-124151651 CTAATTATATTAAATAAAAATGG + Intergenic
1047562062 8:125997683-125997705 CTAATGATAATGAGTTAAATGGG - Intergenic
1047916162 8:129585918-129585940 CTGATAATAATGAATGAAAAAGG + Intergenic
1051009839 9:12397864-12397886 CTGATGAAAATAAGAAAAAATGG + Intergenic
1051962472 9:22784612-22784634 CGAATGATGTTGAATAAAAAAGG + Intergenic
1053658125 9:40241228-40241250 CCTATGAGGTTGAGTAAAAATGG - Intronic
1053908498 9:42870502-42870524 CCTATGAGGTTGAGTAAAAATGG - Intergenic
1054358626 9:64090158-64090180 CCTATGAGATTGGGTAAAAATGG - Intergenic
1054370246 9:64387503-64387525 CCTATGAGGTTGAGTAAAAATGG - Intronic
1054526471 9:66134993-66135015 CCTATGAGGTTGAGTAAAAATGG + Intronic
1054677877 9:67877259-67877281 CCTATGAGGTTGAGTAAAAATGG - Intronic
1055225747 9:73992539-73992561 CTGATGAGGTTGTGGAAAAAAGG + Intergenic
1058230057 9:102414638-102414660 GTGATGATATTGAGTCTGAAAGG - Intergenic
1058540984 9:106012447-106012469 CTGATGAGAATGACTGAAAATGG + Intergenic
1061927791 9:133814599-133814621 CTGATGACATGGATCAAAAACGG + Intronic
1203704124 Un_KI270742v1:22003-22025 CCTATGAGATTGAGTAAAAATGG - Intergenic
1203559878 Un_KI270744v1:43818-43840 CCTATGAGATTGAGTAAAAATGG + Intergenic
1186600469 X:11031086-11031108 CAGATGATATTTTCTAAAAATGG - Intergenic
1187227175 X:17384585-17384607 CTGATGGCATTGTGTAGAAAAGG - Intronic
1188528400 X:31111131-31111153 CTTAGGATATTAAGTTAAAAGGG - Intronic
1189021120 X:37341721-37341743 CTGATGAGACTTAGTAAATATGG + Intergenic
1191076603 X:56460473-56460495 CTGATGATACTGAGTCAAACAGG - Intergenic
1192659261 X:73024605-73024627 ATAATTATCTTGAGTAAAAATGG - Intergenic
1193928713 X:87524699-87524721 CTGAGGAAATTGAACAAAAATGG + Intronic
1194292356 X:92089973-92089995 ATGATCATCTTGAGGAAAAATGG - Intronic
1194546602 X:95242485-95242507 ATGAAGATATTCAGTACAAATGG + Intergenic
1195777701 X:108425957-108425979 CTGTTGATAATGAAGAAAAATGG - Intronic
1195878876 X:109572164-109572186 CTGATCAATTTGAGTAACAAGGG - Intergenic
1196074634 X:111561814-111561836 GTGATAATATTGAGTGCAAAAGG - Intergenic
1196338851 X:114572202-114572224 CTGATGATATAGAAATAAAAAGG + Intergenic
1196542702 X:116927994-116928016 GTGAACATATTGACTAAAAACGG - Intergenic
1196928499 X:120657887-120657909 CTGATTATGTTGAGTGAAAAAGG + Intergenic
1198176550 X:134161728-134161750 CTGACAGTATTGAGTATAAATGG - Intergenic
1200609864 Y:5314599-5314621 ATGATCATCTTGAGGAAAAATGG - Intronic