ID: 975830315

View in Genome Browser
Species Human (GRCh38)
Location 4:78362275-78362297
Sequence ACTGGTATACTGACTCTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 100}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975830312_975830315 -2 Left 975830312 4:78362254-78362276 CCATTCATACTGAAGGCTGAGAC 0: 1
1: 0
2: 1
3: 7
4: 179
Right 975830315 4:78362275-78362297 ACTGGTATACTGACTCTGGAAGG 0: 1
1: 0
2: 1
3: 8
4: 100
975830310_975830315 5 Left 975830310 4:78362247-78362269 CCTCAGTCCATTCATACTGAAGG 0: 1
1: 0
2: 2
3: 10
4: 124
Right 975830315 4:78362275-78362297 ACTGGTATACTGACTCTGGAAGG 0: 1
1: 0
2: 1
3: 8
4: 100
975830309_975830315 20 Left 975830309 4:78362232-78362254 CCAATTATTTACTAACCTCAGTC 0: 1
1: 0
2: 0
3: 8
4: 132
Right 975830315 4:78362275-78362297 ACTGGTATACTGACTCTGGAAGG 0: 1
1: 0
2: 1
3: 8
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975830315 Original CRISPR ACTGGTATACTGACTCTGGA AGG Intronic
906805915 1:48778311-48778333 TCTGGTACACTGACTTTGCAAGG - Intronic
914141392 1:144952108-144952130 AGTGGTATCCTGAATTTGGAAGG + Intronic
915140115 1:153762590-153762612 AATGGAATACTGACCCTGGGAGG - Intronic
918638150 1:186804674-186804696 ACTGGGAAACTGAATATGGAAGG - Intergenic
922108028 1:222529350-222529372 AATGGTAGAATCACTCTGGATGG - Intronic
1063711963 10:8487914-8487936 CCTGGTGTGCTCACTCTGGAAGG - Intergenic
1074801086 10:117002117-117002139 ACTGGTATAATCATTTTGGAGGG + Intronic
1076496759 10:130902571-130902593 ACTGGGCAACTGACTCTGAACGG + Intergenic
1076852118 10:133098404-133098426 CCTGGCACACTGACGCTGGAAGG - Intronic
1079150220 11:17892226-17892248 GCTGGTAAACTGTCTCTGAATGG - Intronic
1079540093 11:21562860-21562882 GCTGGTGTACTGACTCTCAAAGG - Intronic
1079814455 11:25038619-25038641 ACTGGAATTCAGAATCTGGATGG - Intronic
1080756687 11:35207013-35207035 AATGGTATGATGACTCTTGAAGG + Intronic
1082246031 11:49923748-49923770 ACTGCTTTACTGACTGGGGAAGG - Intergenic
1084629434 11:70336938-70336960 AGTGGGATAATGACTCTGTATGG - Intronic
1084813563 11:71631503-71631525 ACTGGGTTCCTGAGTCTGGAGGG - Intergenic
1086364852 11:86098580-86098602 ACTGTTATACCAACTCTGGATGG + Intergenic
1087419252 11:97899823-97899845 ACTGGTCTACTCACTCTAAATGG - Intergenic
1090326041 11:125887382-125887404 TCTGGTGTACTAAATCTGGAGGG - Exonic
1097308859 12:58097104-58097126 ACTGGAAAACTGATTCTGGCTGG - Intergenic
1101295101 12:103414364-103414386 ACTGGTATCCAGAATCTGCAAGG - Intronic
1102900003 12:116628993-116629015 ACTAGATTACAGACTCTGGAAGG + Intergenic
1103298883 12:119911943-119911965 ACTGTTATAATAAATCTGGAAGG + Intergenic
1105663281 13:22523439-22523461 ACTGATATGCAGACTGTGGAAGG + Intergenic
1106062299 13:26306142-26306164 AGAAGTATACTGACTCTGGTAGG - Intronic
1107049767 13:36034678-36034700 GCAGGTAAACTGACTCTTGAGGG + Intronic
1108150236 13:47525911-47525933 ACTGGTTTACACATTCTGGAGGG + Intergenic
1109982878 13:69933619-69933641 ACTCTTACACTGACTCTGGAAGG + Intronic
1111121939 13:83864176-83864198 TCTGGGATACTGACTCATGAAGG - Intergenic
1112264999 13:97915489-97915511 AATGGTAGAATCACTCTGGAAGG + Intergenic
1114453131 14:22839186-22839208 ACTGGTCTACTGACGCTGGAAGG - Intronic
1114939732 14:27593382-27593404 ACTGGTAAAATGTCTCTGCAAGG - Intergenic
1115940973 14:38609303-38609325 ACTGGGGTACTGGCTCTGGAGGG - Intergenic
1117020254 14:51563137-51563159 CCTGGGATACTCACTCTGGGAGG - Intronic
1118497021 14:66316846-66316868 ACTGTTATTCTGACCCTGGTGGG - Intergenic
1122016805 14:98803390-98803412 ACTGGTTTCCTGAGTCTGGATGG - Intergenic
1123780419 15:23621358-23621380 AATTGTCTGCTGACTCTGGAAGG + Intronic
1125032963 15:35091329-35091351 TCTGGTATAATGACTTTGGAGGG + Intergenic
1131225140 15:90618399-90618421 ACTTGTCTACTGACTCTTGGAGG - Intronic
1131889161 15:96953349-96953371 TCTGTTATTCTAACTCTGGATGG - Intergenic
1137821408 16:51449237-51449259 ACTGGGCTACTGACTGTGGTGGG + Intergenic
1140145517 16:72303235-72303257 ACTGGAATATAAACTCTGGAAGG - Intergenic
1140964891 16:79956111-79956133 ACTGGTATACTAAATCTGCATGG + Intergenic
1141017704 16:80466067-80466089 CCTGGTATCCTGTCTCTGTAAGG + Intergenic
1142546673 17:708754-708776 TCTGGTCTCCTGACTCTGTATGG + Intronic
1143544371 17:7587920-7587942 CCTGGAAGACTGAGTCTGGACGG + Exonic
1147010810 17:37445934-37445956 ACTGGTACACTGTCCCTAGAAGG + Intronic
1147286819 17:39408966-39408988 GCTGGTATACTGACTGTGAGAGG + Exonic
1151072693 17:71234151-71234173 ACAGGTATTCTGCTTCTGGAAGG + Intergenic
1151279949 17:73065987-73066009 AAAGGAATACTGATTCTGGAAGG + Intronic
1151471108 17:74318327-74318349 ACTGGTGTACCGGCTCTGGGAGG - Intergenic
1151672789 17:75580953-75580975 ACTGGTCTCCTGAGTCTGGTGGG + Intergenic
1157053397 18:44196664-44196686 ATTGGTATATTCAGTCTGGATGG - Intergenic
1158738730 18:60114408-60114430 ACTAGTATACTGTCTCTATAGGG - Intergenic
1159225618 18:65531244-65531266 ACTGACAATCTGACTCTGGAGGG - Intergenic
1167713690 19:51127288-51127310 ACTGGTGCACTCACTCTGCAGGG - Exonic
925192934 2:1899895-1899917 ACTGGTGTGCTGTGTCTGGAAGG + Intronic
926767229 2:16332169-16332191 ACTGGTAGACAGACTCAGGCAGG + Intergenic
929163481 2:38857030-38857052 ACTGGTATAGAGACTCTTGTTGG - Intronic
929536426 2:42787113-42787135 ACAGGTGTCCTCACTCTGGAGGG - Intronic
935205060 2:100890193-100890215 CCTGGTATAATGCCTCTGCAAGG + Intronic
940134341 2:150419207-150419229 ACTGGTATACCAACTCTACATGG + Intergenic
942248025 2:174025281-174025303 TCTGGTCTCCTGACTCTGGCAGG + Intergenic
943957629 2:194213076-194213098 ACTGGTGTAGTGAATCTTGATGG + Intergenic
945709299 2:213276481-213276503 CCTGGTAAATTGACTCTGTATGG - Intergenic
1169813752 20:9634830-9634852 AAAGGCATACTGACACTGGAAGG + Intronic
1172049142 20:32103060-32103082 ACTGGTATCCAGATGCTGGATGG + Intergenic
1179405816 21:41124860-41124882 ATTGGCTTACTGACTCTAGAGGG - Intergenic
1181846577 22:25714845-25714867 ACTGTCATACTCAATCTGGAAGG - Intronic
1183964801 22:41435247-41435269 ACTGGTTTGCAGACTGTGGAAGG - Exonic
949520595 3:4849963-4849985 ACTGATATCCCCACTCTGGAAGG - Intronic
953326007 3:42013327-42013349 TCTCTTAGACTGACTCTGGAAGG + Intergenic
958484424 3:94685604-94685626 ACTGGTATCCAGACTCTACAAGG + Intergenic
960855391 3:122097514-122097536 ACTGGTATACTCACTCTATGTGG - Intronic
969400013 4:6948381-6948403 ACTGGCAAACTGACCCTGGGAGG + Intronic
971691596 4:29844116-29844138 ACTTTTATATTGACTCTGAAAGG - Intergenic
971878011 4:32329082-32329104 ACAGGTATTCTGAATCTGGCAGG - Intergenic
972961194 4:44454113-44454135 AATGATATTCTGATTCTGGATGG + Intergenic
973778766 4:54268698-54268720 AGTGGGATACTGAATCTGGAAGG + Intronic
974478794 4:62418933-62418955 CCTGGTAGAGTGACTCTGAAGGG + Intergenic
975830315 4:78362275-78362297 ACTGGTATACTGACTCTGGAAGG + Intronic
978067665 4:104425431-104425453 CCTTGTATAGTCACTCTGGAAGG + Intergenic
980163109 4:129190402-129190424 ATTGGTACAATGACTTTGGAGGG + Intergenic
981953692 4:150443950-150443972 ACTGGTACGCTGCCTCTGCAAGG + Intronic
988046242 5:25958435-25958457 AGTGGTGTACTGATTTTGGAAGG - Intergenic
988222694 5:28369392-28369414 ACTGGTATCCTGACTGTTGCGGG - Intergenic
994048570 5:95336686-95336708 ACTGGTACAGTAACTATGGAGGG + Intergenic
1006642149 6:35495026-35495048 ACTGGGAGACAGACTCTGGGAGG + Intronic
1011043511 6:83057034-83057056 ACTGGTATAATGATTCGGTAAGG - Intronic
1012288308 6:97421186-97421208 AGTGCTATACTGGCTATGGAAGG - Intergenic
1016761733 6:147745588-147745610 CCTGGTTTACCCACTCTGGATGG - Intergenic
1017919866 6:158862204-158862226 ACTAGTCTACTGACTCTGCCAGG + Intergenic
1018444335 6:163841548-163841570 GCTGGTATGGTGACTCTGGCTGG + Intergenic
1023729516 7:43177314-43177336 ACTGGTAGATTCACTGTGGAAGG - Intronic
1024764597 7:52642315-52642337 GATTGTATACTGATTCTGGAAGG + Intergenic
1024804316 7:53118986-53119008 ACAGGTTTAATGTCTCTGGAGGG - Intergenic
1028394943 7:90358862-90358884 ACTAATATACTGAGTCTGCAAGG + Intronic
1028467437 7:91168861-91168883 ACTTGTTTTATGACTCTGGATGG - Intronic
1031104393 7:117523075-117523097 ACTGGTAGCATTACTCTGGAAGG - Intronic
1031754310 7:125618594-125618616 ACTGATATCCTGCCGCTGGAGGG + Intergenic
1037283749 8:17273357-17273379 ACTGGTACAACTACTCTGGAGGG - Intronic
1038717501 8:30005033-30005055 ACTGGTGTCCTAACTCTGGAAGG + Intergenic
1045827045 8:106410447-106410469 ACTGGTTTACTGAATATTGAAGG - Intronic
1051257780 9:15232733-15232755 TCTGGTGTACTAAATCTGGAGGG + Intronic
1056085506 9:83145321-83145343 AGTGGTATAGTAACCCTGGATGG - Intergenic
1059054983 9:110969973-110969995 ATTGGTACAGTCACTCTGGAGGG - Intronic
1061945773 9:133907619-133907641 ACTGATTTATGGACTCTGGAGGG + Intronic
1187595386 X:20766052-20766074 ACTGGGACACTGATTCTGTAAGG - Intergenic
1198953371 X:142098664-142098686 AATGCAATAATGACTCTGGAAGG - Intergenic
1199474458 X:148230436-148230458 AGTGGGATTCTGACTCAGGAAGG + Intergenic