ID: 975830570

View in Genome Browser
Species Human (GRCh38)
Location 4:78363973-78363995
Sequence AACCTCGTGCTGTCCCACAC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 75}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975830568_975830570 -9 Left 975830568 4:78363959-78363981 CCTCATGTGACACCAACCTCGTG 0: 1
1: 0
2: 0
3: 5
4: 75
Right 975830570 4:78363973-78363995 AACCTCGTGCTGTCCCACACTGG 0: 1
1: 0
2: 1
3: 6
4: 75
975830565_975830570 17 Left 975830565 4:78363933-78363955 CCAGGGCAGAGGACCTTTCTCCT 0: 1
1: 0
2: 0
3: 28
4: 242
Right 975830570 4:78363973-78363995 AACCTCGTGCTGTCCCACACTGG 0: 1
1: 0
2: 1
3: 6
4: 75
975830564_975830570 21 Left 975830564 4:78363929-78363951 CCTGCCAGGGCAGAGGACCTTTC 0: 1
1: 0
2: 0
3: 24
4: 189
Right 975830570 4:78363973-78363995 AACCTCGTGCTGTCCCACACTGG 0: 1
1: 0
2: 1
3: 6
4: 75
975830567_975830570 -3 Left 975830567 4:78363953-78363975 CCTGCTCCTCATGTGACACCAAC 0: 1
1: 0
2: 2
3: 9
4: 124
Right 975830570 4:78363973-78363995 AACCTCGTGCTGTCCCACACTGG 0: 1
1: 0
2: 1
3: 6
4: 75
975830566_975830570 4 Left 975830566 4:78363946-78363968 CCTTTCTCCTGCTCCTCATGTGA 0: 1
1: 0
2: 3
3: 28
4: 380
Right 975830570 4:78363973-78363995 AACCTCGTGCTGTCCCACACTGG 0: 1
1: 0
2: 1
3: 6
4: 75
975830562_975830570 30 Left 975830562 4:78363920-78363942 CCTGCAGAACCTGCCAGGGCAGA 0: 1
1: 0
2: 2
3: 36
4: 269
Right 975830570 4:78363973-78363995 AACCTCGTGCTGTCCCACACTGG 0: 1
1: 0
2: 1
3: 6
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975830570 Original CRISPR AACCTCGTGCTGTCCCACAC TGG Exonic
900163074 1:1233509-1233531 ACCCCCGTGCTGTCCCCGACCGG + Exonic
910882832 1:91937982-91938004 GATCTGGTGCTGTCCCACTCCGG + Intergenic
911870426 1:103090092-103090114 AGCCTCGTTCTGTCCCAGGCTGG - Intronic
920345691 1:205304389-205304411 AGCCTCCTGCTCTCCCACTCGGG + Exonic
922936861 1:229429832-229429854 AACCTTGTATTGTCCCACTCAGG - Intergenic
923162822 1:231331426-231331448 TACCTCTTGCTGTACCCCACTGG - Intergenic
1063377305 10:5561928-5561950 CACCTCCTGGTGTCCCACTCAGG + Intergenic
1063689790 10:8275951-8275973 AACCTGGTGCTCTCCACCACAGG - Intergenic
1067558744 10:47289756-47289778 AAACCTGTGCTGTCACACACTGG - Intergenic
1067576575 10:47412473-47412495 GACCTGGTGCTGGCCCACATTGG - Intergenic
1070719094 10:78744207-78744229 TTCCTGGAGCTGTCCCACACTGG - Intergenic
1076889852 10:133278073-133278095 GACCTCGTCCTGTGCCACACAGG - Intergenic
1080519879 11:33059461-33059483 AATTTCCTGCTGTGCCACACAGG - Intronic
1080896832 11:36454753-36454775 ATCCTCGTGCAGTCAAACACAGG - Intronic
1083117550 11:60476932-60476954 AATCTCTTGCAGTTCCACACTGG + Intergenic
1088396268 11:109373417-109373439 GAACTCCTGCTGACCCACACTGG - Intergenic
1091258350 11:134211869-134211891 AACATCGTGCAGTCTAACACAGG + Intronic
1103407432 12:120686260-120686282 CACCTGGCGCTCTCCCACACTGG - Intergenic
1105863656 13:24439917-24439939 AACATCGTGGGCTCCCACACTGG - Intronic
1118572871 14:67211355-67211377 AACATGGTTCTGTACCACACAGG + Intronic
1119948996 14:78725210-78725232 AACCTCCTGCTGTGGCTCACTGG + Intronic
1202859515 14_GL000225v1_random:72615-72637 CACCTGGTGCTCTCCCACAGGGG - Intergenic
1127901585 15:63345122-63345144 AATCTCCTGCTGACTCACACTGG - Intronic
1130294052 15:82630797-82630819 TACCTAATGCTGTACCACACTGG - Intronic
1140711861 16:77686109-77686131 AACCTAGTGCTGTCCTACTGAGG + Intergenic
1141820356 16:86441532-86441554 GAGCTCGAGCTGGCCCACACTGG - Intergenic
1142741644 17:1935043-1935065 TCCCTCCTGCTGTCCCACACAGG + Exonic
1150028737 17:61708304-61708326 AATCTCATGCTGTCCCACTCAGG + Intronic
1152280506 17:79382443-79382465 AACCACGTGCCGCCCAACACAGG - Intronic
1161085685 19:2333938-2333960 AACCTCAGCCTGTCCCACTCAGG + Intronic
1161682425 19:5686911-5686933 TACCTCGTGCTGAACCACATCGG + Exonic
1161967941 19:7559042-7559064 AACCTCTAGCTGCCGCACACAGG - Exonic
1165103839 19:33457038-33457060 AGCCTCGTGTAGCCCCACACGGG + Intronic
1166199581 19:41227942-41227964 AACCTCATGCCATCCCACTCTGG - Intronic
1167210457 19:48130979-48131001 AACCCCGCACTGTGCCACACTGG + Intronic
1168628371 19:57936965-57936987 AGTCTCGTTCTGTCCCAGACTGG + Intergenic
930377984 2:50591724-50591746 AACCATGTGCTGTCCCAGATAGG - Intronic
932146077 2:69318570-69318592 AACCTTGAGCTGTCCCACCCAGG + Intergenic
932552033 2:72781382-72781404 AGCCTCCTGCTGACCCACAATGG - Intronic
944508872 2:200444800-200444822 AACCTCCTGCTGCCCCATACAGG + Intronic
946576389 2:221080535-221080557 AAAATGGTGCTTTCCCACACTGG - Intergenic
1174158925 20:48536578-48536600 CACCTTGTGCTGTCTCACCCTGG - Intergenic
1177726802 21:24979477-24979499 AATCTCATGCTGTCCCTCCCGGG - Intergenic
1179005443 21:37509929-37509951 AATCTCATGCTGTCCCACCCTGG + Intronic
1179491631 21:41744983-41745005 GACCTCGAGCCGTCCCACAAAGG - Intronic
954924921 3:54225415-54225437 AACCTCATGGAGTCCCACAAGGG - Intronic
957919962 3:86733876-86733898 AAACTCCTGCTGTCCCATAGCGG - Intergenic
960679379 3:120231116-120231138 AATCTCATGCTGTTCCACTCTGG - Intronic
961066472 3:123881202-123881224 GACATCGTTCTGTCCCACTCTGG + Intronic
961112554 3:124297475-124297497 AGCCTCGAGCTGTGGCACACTGG + Intronic
961414386 3:126746625-126746647 ATCTTCGTGCTGACACACACTGG + Intronic
961706242 3:128788053-128788075 AAGCTTGTGCTATCCCACCCAGG + Intronic
961743159 3:129046492-129046514 AACCCGGTGGTGCCCCACACTGG - Intergenic
966918560 3:184597950-184597972 AACCTTGTCCTGTCCCACACAGG - Intronic
969405111 4:6986590-6986612 AGCCTCGTGTTGTCGCAGACCGG + Intronic
975830570 4:78363973-78363995 AACCTCGTGCTGTCCCACACTGG + Exonic
978624972 4:110675003-110675025 TAACTGGTGCTGTCACACACAGG - Intergenic
990569835 5:57067089-57067111 AATCTCATGTTGTCCCACCCAGG + Intergenic
995114303 5:108461855-108461877 AATCTCCTGCTGTCCCACTAGGG + Intergenic
997350082 5:133224806-133224828 ATCCACGTGATGTCCCACAGTGG - Intronic
1002271615 5:178076096-178076118 AACCTCGTTCTGTCCAACTGTGG + Intergenic
1010804267 6:80216215-80216237 AAGCCAGTGCTGTCCCCCACTGG - Intronic
1011366412 6:86586983-86587005 AACCTCGCTCTGTCCCAGGCTGG - Intergenic
1011481310 6:87796576-87796598 AATCCCCTGCTGTCACACACTGG + Intergenic
1017589007 6:155958718-155958740 CACCTGGGGCAGTCCCACACAGG + Intergenic
1018816065 6:167332222-167332244 AACCCCGTGCTGTAACAAACAGG - Intronic
1019054498 6:169213591-169213613 CACCCCGTGCAGTCCCACAGGGG - Intergenic
1019999973 7:4750003-4750025 AACCCCATGCTGACCCACCCCGG - Intronic
1024748236 7:52431564-52431586 AAACTCGTGCTGGCCCACGAGGG + Intergenic
1033180623 7:139174300-139174322 CACCTGGTGCTGGGCCACACTGG + Intronic
1034831551 7:154312517-154312539 AGTCTCGTGCAGTTCCACACTGG - Intronic
1045062204 8:98420186-98420208 AATCTCTTGCTGTCCCATCCAGG + Intronic
1045933708 8:107655641-107655663 GAACTCGTGCTGGCCCACAAGGG - Intergenic
1049841738 8:144777625-144777647 CACCTAGTGCTGTCTCACCCTGG + Intronic
1057367156 9:94433236-94433258 CCCCTCGCTCTGTCCCACACTGG + Intronic
1057656178 9:96954834-96954856 CCCCTCGCTCTGTCCCACACTGG - Intronic
1057827325 9:98381048-98381070 AATTTCCTGGTGTCCCACACTGG - Intronic
1061730027 9:132606571-132606593 AACATCGTGGTGTCCGGCACGGG - Intronic
1189096809 X:38149056-38149078 ACCAGCGTGCTGTCCCACAGGGG + Intronic
1198103460 X:133441119-133441141 ATCCTAGTTCTTTCCCACACAGG - Intergenic
1201176993 Y:11315513-11315535 CACCTGGTGCTCTCCCACAGGGG + Intergenic
1202370559 Y:24192872-24192894 AGGCCCGTTCTGTCCCACACTGG + Intergenic
1202500225 Y:25477245-25477267 AGGCCCGTTCTGTCCCACACTGG - Intergenic