ID: 975836358

View in Genome Browser
Species Human (GRCh38)
Location 4:78426279-78426301
Sequence TGAAAGCTTGAGTAGGTGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 315
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 286}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975836353_975836358 -4 Left 975836353 4:78426260-78426282 CCAAGCCTCAACTCTTACCTGAA 0: 1
1: 0
2: 3
3: 26
4: 260
Right 975836358 4:78426279-78426301 TGAAAGCTTGAGTAGGTGAAGGG 0: 1
1: 0
2: 0
3: 28
4: 286
975836354_975836358 -9 Left 975836354 4:78426265-78426287 CCTCAACTCTTACCTGAAAGCTT 0: 1
1: 0
2: 0
3: 18
4: 198
Right 975836358 4:78426279-78426301 TGAAAGCTTGAGTAGGTGAAGGG 0: 1
1: 0
2: 0
3: 28
4: 286
975836352_975836358 8 Left 975836352 4:78426248-78426270 CCATTTTGGTTTCCAAGCCTCAA 0: 1
1: 0
2: 0
3: 20
4: 226
Right 975836358 4:78426279-78426301 TGAAAGCTTGAGTAGGTGAAGGG 0: 1
1: 0
2: 0
3: 28
4: 286

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975836358 Original CRISPR TGAAAGCTTGAGTAGGTGAA GGG Intronic
900883465 1:5399105-5399127 TGAAAGTTTGGATGGGTGAATGG + Intergenic
902603911 1:17558245-17558267 TGAATGAATGAGTAGGTGGATGG - Intronic
903431556 1:23305741-23305763 TGAAAGCTAGGGTAGCTGATAGG - Intronic
903747125 1:25595096-25595118 TGAAAGTTTGGGTAGAAGAATGG - Intergenic
904747628 1:32720709-32720731 TGAAAGCTTGAATTAGAGAAGGG + Intergenic
906291650 1:44623338-44623360 TGAAAGCATCAGTTGGAGAAAGG + Intronic
907498643 1:54862085-54862107 TGAAGTCTTGAGTAGGGGAGTGG - Intronic
908101364 1:60794705-60794727 TGAAAGCCTGAATAGATGAAAGG + Intergenic
909127484 1:71692458-71692480 TCAAAGTTTGAGTAGGGCAAAGG - Intronic
909380718 1:74995568-74995590 AGAAAGCATGAGTAGCTGATAGG - Intergenic
909434758 1:75628086-75628108 TACAAGTTTGAGTAGGTGATAGG + Intergenic
909540045 1:76781209-76781231 TGGATGCTTGAGTAAATGAATGG + Intergenic
909809786 1:79918290-79918312 TGAAGTCTAGAGTAGGTGAAAGG + Intergenic
910368005 1:86487240-86487262 TCAAAGCTTGGGTGGGTGACAGG - Intronic
910596387 1:88985211-88985233 TGGAAGAGTGAGTAAGTGAAGGG + Intronic
916333028 1:163639551-163639573 GGCAAGCTTCAGTAAGTGAATGG - Intergenic
916464531 1:165061049-165061071 TGAAAGCATGATAAGGTGCATGG + Intergenic
916869812 1:168901414-168901436 TGAAAGCTTGAGATGATGGAGGG - Intergenic
918334911 1:183499160-183499182 TGGTTGCTTCAGTAGGTGAATGG + Intronic
918348483 1:183628714-183628736 TAAAAGAATGAGTAGGTGACAGG + Intronic
918638140 1:186804533-186804555 TTAAAGGATGAGTAGATGAATGG - Intergenic
920846512 1:209597609-209597631 TGAAGGGATGAGTAAGTGAATGG + Intronic
920854199 1:209650219-209650241 TGGAAGCTTGAGTGAGGGAAAGG - Intronic
921127710 1:212192387-212192409 AGACATCTTCAGTAGGTGAATGG + Intergenic
922422421 1:225468701-225468723 TGAAAACTTGAGAAGGAGTAGGG + Intergenic
922575269 1:226656849-226656871 TGAGAGCCTGAGCAGGTGACAGG + Intronic
923787861 1:237085477-237085499 TGGAAGCTGGAGGAGGAGAAGGG + Intronic
924204071 1:241693162-241693184 AGAAATCTTCAGTAGCTGAATGG + Intronic
924380077 1:243454792-243454814 TGAAATCCTGACCAGGTGAACGG - Intronic
1063114218 10:3062483-3062505 TGAAAGGGTGAGTCAGTGAATGG - Intergenic
1063467868 10:6259370-6259392 TGAATGGATGAGTTGGTGAATGG - Intergenic
1063541749 10:6941193-6941215 TGAAAGGTTGAGAAAGGGAAAGG - Intergenic
1064491260 10:15860015-15860037 GGAGAGTTTGAGTAGGAGAATGG - Intronic
1064786660 10:18905155-18905177 GTAAGCCTTGAGTAGGTGAATGG + Intergenic
1073067264 10:100770091-100770113 TGAATGCCTGAGTAGGCGAAAGG + Intronic
1073388221 10:103146643-103146665 TTTAAGCTTGAGTGGGAGAATGG - Intronic
1073844807 10:107543225-107543247 AGAAAGCATGGGTAGGAGAAGGG + Intergenic
1075524989 10:123176526-123176548 TGAATGCGTGAATGGGTGAATGG - Intergenic
1077171799 11:1169770-1169792 TGAAAGCGTGAGTGGGTGAGTGG - Intronic
1077171821 11:1169886-1169908 TGAATGGTTGAGTCGGTGAGTGG - Intronic
1077171846 11:1170018-1170040 TGAATGGTTGAGTCGGTGAGTGG - Intronic
1077171931 11:1170497-1170519 TGAATGGTTGAGTCGGTGAGTGG - Intronic
1077271182 11:1682444-1682466 CAAAAGCTTCAGTAGGTGAATGG + Intergenic
1077599718 11:3565946-3565968 TGGATGGTTGAGTCGGTGAAGGG + Intergenic
1078001923 11:7503750-7503772 TAAGTTCTTGAGTAGGTGAAAGG + Intronic
1078048506 11:7940474-7940496 TTAAAGGTAGAGGAGGTGAAGGG - Intergenic
1078867291 11:15309818-15309840 TGAGAGCTTGAGCAGGTGGCTGG - Intergenic
1079363481 11:19789369-19789391 TGAAAGTTTGAGAAGGTCAAAGG - Intronic
1084565294 11:69925087-69925109 TGTATGGTTGAGTAGGTGGATGG + Intergenic
1084623824 11:70292955-70292977 TCAAAGGTGGAGTAGGTGCAAGG - Intronic
1084773838 11:71362459-71362481 TGAATGGTTGAGTAGTTGAATGG + Intergenic
1084773839 11:71362483-71362505 TGAATGATTGAGTAGTTGAATGG + Intergenic
1084773930 11:71363289-71363311 TGAATGGGTGAGTAGTTGAATGG + Intergenic
1084773934 11:71363337-71363359 TGAGTGGTTGAGTATGTGAATGG + Intergenic
1084817125 11:71654766-71654788 TGGATGGTTGAGTCGGTGAAGGG - Intergenic
1085359508 11:75873811-75873833 TGTAAGGTAGAGTTGGTGAAGGG + Intronic
1085841182 11:80013247-80013269 TGAAAGCTTGAGGGGATGGATGG - Intergenic
1086036517 11:82422086-82422108 TGGAAGCTTCAGTGGATGAATGG - Intergenic
1088410943 11:109533860-109533882 TGAATGCCTGAGGAGGTGATGGG - Intergenic
1089567976 11:119382117-119382139 TGAATGCCTGAGTGGGTAAACGG + Intergenic
1092860358 12:12715010-12715032 TGAAAGATTCAGCATGTGAAGGG + Intergenic
1093554339 12:20452870-20452892 TGTTACCTTGATTAGGTGAAGGG + Intronic
1094378663 12:29818718-29818740 TGAAAGCTTTAGCAGGTCAGTGG + Intergenic
1098471659 12:70852082-70852104 TGAGTGCATGAGTGGGTGAAGGG + Intronic
1098770899 12:74551789-74551811 TGTAAGCTTCACTAGGCGAAAGG + Intergenic
1098921006 12:76302170-76302192 TGAGTGCTTGAGTAGGTGAGAGG - Intergenic
1100032823 12:90214085-90214107 TAAAAGCAGGAGTAGGGGAAGGG - Intergenic
1101433666 12:104646843-104646865 TGAATGATTGAGTAAATGAATGG - Intronic
1103184061 12:118941069-118941091 TGAATGAATGAGTAGGTGAATGG - Intergenic
1106000566 13:25719420-25719442 TGAAAGGTTGGGTGGGTGGATGG + Intronic
1106678585 13:31986992-31987014 TGGAAGCTTCATTAGGGGAAAGG - Intergenic
1106877963 13:34096091-34096113 TGTCAGCTTGAGTGGGTTAAGGG - Intergenic
1107413297 13:40177384-40177406 CGGAAGCTTGAGTAGGTCACAGG + Intergenic
1108019263 13:46109938-46109960 TGAAAGCCTGAATAGGAAAATGG + Intergenic
1108120743 13:47183374-47183396 TGAAAGCCTGAGAAGGGAAATGG - Intergenic
1108256766 13:48618658-48618680 TGACAGCTTGACTAGGGGCAGGG - Intergenic
1108352083 13:49596971-49596993 TGAAAGCAGGAGGAAGTGAAGGG + Intergenic
1110024489 13:70517929-70517951 TGAAAGCTGTAATATGTGAATGG + Intergenic
1110280780 13:73691984-73692006 TGAAAGCTTAAGTGGGAAAAAGG - Exonic
1110591884 13:77272684-77272706 AGAAATCTTGAGTAAGGGAATGG + Intronic
1110979590 13:81879266-81879288 TGAAAGCTCAAGTAGAAGAAGGG + Intergenic
1114323614 14:21567758-21567780 GGAAAGCTAGTGTTGGTGAAAGG - Intergenic
1115846748 14:37543930-37543952 TGAAAGGTTGAGTGAGTGAATGG + Intronic
1115875319 14:37854581-37854603 TGAATGCTTTAGTGGGTGAAGGG + Intronic
1116114260 14:40628408-40628430 TGAAATCTTTAGGAGGTGATTGG + Intergenic
1117274201 14:54176113-54176135 TGAAAGGTTAAGTATGGGAAGGG - Intergenic
1117973080 14:61271392-61271414 TGAAGGCGTGAGAAGGTGGAGGG - Intronic
1118895542 14:69942773-69942795 TGAAAGATTGAGAAGGAGCATGG + Intronic
1119180734 14:72603502-72603524 TGAATGATTGAGTGTGTGAATGG - Intergenic
1119291735 14:73500752-73500774 TGAAAGTTTAAGGAGGTGAAAGG - Intronic
1119509296 14:75198530-75198552 TGGAAGCTTGAGAAGGGGGAAGG - Intergenic
1119712370 14:76831399-76831421 TGAAACCTGGAGGAGGTGGAGGG + Intronic
1119881698 14:78104820-78104842 TGAAAGCTGGAGTGGGTGGCGGG + Intergenic
1119991008 14:79197220-79197242 TAAAAACTTGGGTAGGTGCATGG + Intronic
1120528235 14:85602543-85602565 TCAAAGCCAGAGTAGCTGAATGG + Intronic
1120775922 14:88438077-88438099 TGAAAAATTCAGTTGGTGAAGGG - Exonic
1122838783 14:104444371-104444393 TGAATGGGTGAATAGGTGAATGG - Intergenic
1122838818 14:104444602-104444624 TGAATGAATGAGTGGGTGAATGG - Intergenic
1126000264 15:44202932-44202954 TGGAAGCTTGAGTGGAGGAATGG - Intergenic
1128154600 15:65384792-65384814 CCAAAGGTTGAGTAGGTGGAGGG - Intronic
1128410779 15:67394837-67394859 TAAATGCTTGAGTAGGAAAAAGG - Intronic
1130980190 15:88807171-88807193 TGGAAGCTGGAGTTGGGGAAAGG + Intronic
1132644881 16:994194-994216 TGGATGGATGAGTAGGTGAAAGG - Intergenic
1133372480 16:5255632-5255654 TGGATGGTTGAGTCGGTGAAGGG - Intergenic
1133581197 16:7146111-7146133 TCAAAGCTTGTCTAGGTTAAGGG + Intronic
1135713941 16:24744486-24744508 TGAATGATTGAGTGAGTGAATGG - Intronic
1140663536 16:77209834-77209856 TGAATGAGTGAGTAGGTGAATGG - Intronic
1142104218 16:88293477-88293499 TGAATGAGTGGGTAGGTGAATGG + Intergenic
1142248452 16:88980300-88980322 TGAATGGGTGAGTAGGCGAATGG + Intergenic
1142248521 16:88980582-88980604 TGAATGGGTGAGTAGGTGAATGG + Intergenic
1143227661 17:5320957-5320979 TTAAAGCCTGAGTGGCTGAATGG + Intronic
1143466533 17:7140511-7140533 TGGAAGCTTGAACGGGTGAATGG - Intergenic
1145278729 17:21453408-21453430 TTAAAGCTTGAGAAGGAGGAGGG + Intergenic
1145399123 17:22517077-22517099 TTAAAGCTTGAGAAGGAGGAGGG - Intergenic
1145863340 17:28225579-28225601 TGAGAGGCTGAGTAGGGGAAGGG - Intergenic
1147308007 17:39576982-39577004 TGAATGCATGGGCAGGTGAAGGG - Intergenic
1147403899 17:40197076-40197098 TGAAAACTTGGGTAGGTGGCTGG - Intergenic
1151509182 17:74547820-74547842 TGAAAGGATGAATGGGTGAATGG + Intergenic
1154229467 18:12541662-12541684 AGAAAGCTTGAGTAAAAGAATGG - Intronic
1156887111 18:42148219-42148241 TAAAAACCTGAGTAGGTGATTGG - Intergenic
1158379625 18:56914626-56914648 TTAAAGATTCAGTAGGTTAATGG + Intronic
1158540509 18:58349262-58349284 TGAGACCTTGAGAAGGGGAAGGG - Intronic
1158880891 18:61778845-61778867 GGAATGCTTGAGTAGGTGGTGGG + Intergenic
1159906236 18:74095159-74095181 AGAAAGCTTTAGTTGTTGAATGG - Intronic
1160692311 19:465714-465736 TGAATGAGTGGGTAGGTGAAAGG + Intronic
1160926623 19:1549744-1549766 TGCATGGGTGAGTAGGTGAATGG - Intergenic
1161372903 19:3923709-3923731 TGAATGGTTGGGTAGATGAATGG + Intronic
1162156598 19:8682556-8682578 TGAATGAATGAGTGGGTGAATGG - Intergenic
1162412183 19:10513169-10513191 TGAAAACCAGAGAAGGTGAAGGG - Exonic
1162804636 19:13130960-13130982 AGAAAGCTGGTGTAGCTGAAGGG - Intronic
1163095030 19:15051011-15051033 TGGAAGGGTGAGTGGGTGAATGG + Intronic
1164607416 19:29610274-29610296 TGAGAGCCTCAGTAGGTAAAGGG + Intronic
1164920402 19:32084827-32084849 TGAATGCATGGGTAGGTGAGTGG + Intergenic
1164920418 19:32084954-32084976 TGAATGGATGAGTAGGTGAGTGG + Intergenic
1166640824 19:44493884-44493906 TGAAGGCTTGACTAGGTGGGAGG - Intronic
1167851414 19:52205304-52205326 TGAAAGAATGAATATGTGAAGGG - Intronic
1168326883 19:55543101-55543123 TGAAAGGTTTGGTAGGTGAGTGG - Intronic
1168508392 19:56955198-56955220 TTAAAGATTGAGAAGCTGAAGGG - Intergenic
925567729 2:5274366-5274388 GGAAAGCTTGAGGGGGTGCAAGG - Intergenic
925783835 2:7408830-7408852 TGAAGGCTTGGGAAGCTGAAGGG + Intergenic
926070310 2:9883386-9883408 TGATTCCTTAAGTAGGTGAATGG - Intronic
926669513 2:15563022-15563044 GGAAAGCTGGAGTTGGAGAATGG - Intergenic
929035234 2:37684525-37684547 AGTAAACTTTAGTAGGTGAATGG + Intronic
931282681 2:60807925-60807947 TGAAAGCTGGGGGAGGTGGAAGG + Intergenic
931780525 2:65575739-65575761 TGAATGGTTGAATAGTTGAATGG + Intergenic
932431598 2:71678840-71678862 TGAACGCATGAGTAGATGAATGG + Intronic
932785285 2:74595701-74595723 TGAAAGATAGTGTATGTGAATGG + Intronic
933144643 2:78836806-78836828 TGAAAGTTTAACTAGGTGAATGG - Intergenic
933510413 2:83233959-83233981 TGAAAGATTGAATATGTAAATGG - Intergenic
933616376 2:84486213-84486235 AGAAAGGTTGAGTAGTTTAAGGG - Intergenic
933626545 2:84607040-84607062 TGAAAACTCGAGTGGATGAATGG + Exonic
934908183 2:98224398-98224420 TTAAAGCTGGAGAAGGTAAAGGG + Intronic
935047749 2:99497477-99497499 AGAAAGCTTCAGGAGGTGTAGGG + Intergenic
937027153 2:118708781-118708803 TGAATGCATGAGTCGGTGAATGG - Intergenic
937721508 2:125102202-125102224 AGAAAGCTTGAAGACGTGAAGGG - Intergenic
938739350 2:134216557-134216579 TGAAAGCTTGACTAGGAAATAGG + Intronic
939494577 2:142912812-142912834 TGGAGGCTGAAGTAGGTGAATGG - Intronic
939971982 2:148672398-148672420 TGAGAGATAGAGTAGATGAATGG - Intronic
940184992 2:150974315-150974337 AGACAGCTTGAGCAGGGGAAAGG - Intergenic
940586587 2:155659465-155659487 AGAAATAATGAGTAGGTGAAAGG + Intergenic
942510048 2:176688424-176688446 TGGAAGCTTGAGTGACTGAATGG + Intergenic
942753209 2:179311426-179311448 TGGAAGACTGAGTAGTTGAATGG + Intergenic
944513687 2:200490053-200490075 TGAAAGCTTTGGGAGATGAACGG + Exonic
944683179 2:202095567-202095589 TGGAAGCTTTAGTTGTTGAAAGG - Intronic
945457555 2:210066862-210066884 TGTCAGGTTGACTAGGTGAATGG + Intronic
946588413 2:221216500-221216522 GGAGACCTGGAGTAGGTGAAGGG - Intergenic
1170076024 20:12420024-12420046 TAAAATCTTGAGTAGGACAAGGG + Intergenic
1171139245 20:22726735-22726757 TGAATGAATGAGTATGTGAATGG - Intergenic
1172179949 20:32996775-32996797 TGAATACATGAATAGGTGAATGG - Intronic
1172794782 20:37529100-37529122 TGGTAGCTTGGGGAGGTGAAGGG + Intergenic
1173175412 20:40761217-40761239 AGCAACCTTCAGTAGGTGAATGG - Intergenic
1173367073 20:42395946-42395968 GTAAAGCTGGAGGAGGTGAAAGG - Intronic
1173596500 20:44262023-44262045 TGAAAGATGGAGTAGGTGAGAGG + Intronic
1175082421 20:56432247-56432269 TGAAAGCTTTATTATCTGAAAGG - Intronic
1178180025 21:30149394-30149416 TAAAAACTTGATTAAGTGAATGG + Intergenic
1179276344 21:39895211-39895233 TGAATGGATGAGTAGTTGAATGG - Intronic
1183530206 22:38349192-38349214 TGACAGCTGGGGTAGGTGCAGGG + Intronic
950203060 3:11058155-11058177 TGGATGGGTGAGTAGGTGAATGG + Intergenic
950750908 3:15127214-15127236 TGGATGGTTGAGTCGGTGAAGGG - Intergenic
951801441 3:26600996-26601018 TGCAAGATTCAGTAGGTCAACGG + Intergenic
952591955 3:34966525-34966547 TGGAAGCATGGGTATGTGAATGG - Intergenic
953569611 3:44060825-44060847 TGAAAACTTGTGTGGTTGAAGGG + Intergenic
954082657 3:48221675-48221697 GGAAAGCTTCATGAGGTGAAAGG + Intergenic
954278223 3:49556188-49556210 GGAAAGCTTCTGTAGCTGAATGG + Intronic
956084518 3:65595984-65596006 TGAAAGCTTTAGCAGTTTAATGG - Intronic
956253727 3:67261727-67261749 TGAAAGCTGGAGAAGGGGATGGG - Intergenic
956730127 3:72188846-72188868 TGAAAGTTTGGGTAGGGGCAGGG - Intergenic
957070534 3:75564579-75564601 TGGATGGTTGAGTCGGTGAAGGG + Intergenic
957368883 3:79264452-79264474 TGAATGCATGAATAGGCGAAGGG - Intronic
957869455 3:86071005-86071027 TGAATGCTTTAGTATGTGAGAGG - Intronic
958567889 3:95837761-95837783 TGAAAATTTGAGTGGGTTAAAGG - Intergenic
959210819 3:103377697-103377719 TGAAACCTTGAGTAATGGAAAGG + Intergenic
960022972 3:112976300-112976322 AAAAAGCTTGAGAAGGGGAAGGG - Intergenic
960837896 3:121926401-121926423 TGAAAGCAGGAGCAAGTGAAGGG - Intronic
961283550 3:125781957-125781979 TGGATGGTTGAGTCGGTGAAGGG - Intergenic
961930373 3:130526903-130526925 TGAAGGCATGAATAAGTGAACGG + Intergenic
962183436 3:133232850-133232872 TGAAAGCTTGAGTATGAGGGTGG + Intronic
964757158 3:160098604-160098626 TGAAAGCTAGAGAATGAGAAGGG - Intergenic
964851621 3:161102295-161102317 AGAAAGCTAGAGTAGGTTATCGG - Intronic
965233671 3:166087429-166087451 TGAAAACAGGAGAAGGTGAATGG - Intergenic
965235235 3:166110027-166110049 GAAAAGCCTGAGTAGGTGTATGG - Intergenic
966741017 3:183233687-183233709 TGAAAGCTAAAGTATGGGAAAGG + Intronic
968021390 3:195393664-195393686 TTAAATGATGAGTAGGTGAAGGG - Intronic
968594748 4:1476556-1476578 TGAATGGATGGGTAGGTGAATGG + Intergenic
969037103 4:4263269-4263291 TGAAAGCTTAATTTGGAGAAGGG + Intergenic
969523097 4:7690204-7690226 TGAAAGGATGAGTGGGTGGATGG + Intronic
969739833 4:9016173-9016195 TGGATGGTTGAGTCGGTGAAGGG - Intergenic
969798986 4:9547693-9547715 TGGATGGTTGAGTCGGTGAAGGG - Intergenic
970005273 4:11404952-11404974 AGAAAGTTAGAGGAGGTGAAAGG + Intronic
970046878 4:11864057-11864079 TGAACTCCTGAGTAGATGAAGGG - Intergenic
971014253 4:22470982-22471004 TGAAAGCAGGAGTGGGTGGATGG + Intronic
971705907 4:30042499-30042521 CTAATGCTTGAATAGGTGAAGGG - Intergenic
972218436 4:36923797-36923819 TGAAAGCATGAGTGGGAGATGGG - Intergenic
974569833 4:63629808-63629830 AAAAAGCTTCAGTACGTGAAAGG + Intergenic
975333931 4:73153111-73153133 TGTAAGCTTGTGCAAGTGAAAGG + Intronic
975836358 4:78426279-78426301 TGAAAGCTTGAGTAGGTGAAGGG + Intronic
976347302 4:84019200-84019222 AGGAAGCATTAGTAGGTGAATGG - Intergenic
976449393 4:85169711-85169733 TTAAAGACTGAGTAGGAGAAAGG + Intergenic
977822649 4:101492325-101492347 TGAAAAGTTGAGTATTTGAAAGG - Intronic
979120890 4:116899630-116899652 TGTCAACTTGAGTAGGTCAAAGG + Intergenic
981389790 4:144175377-144175399 TGAAACCTTGAAAATGTGAAAGG - Intergenic
982194516 4:152897263-152897285 TGAAAGCCTGAGTGGGTGCTGGG + Intronic
983561775 4:169108838-169108860 TCTAAGCTTTAGTAGGTGTAGGG - Intronic
983685136 4:170399490-170399512 TGAAACATTAAGTAAGTGAAGGG - Intergenic
983798052 4:171891029-171891051 AGCAAGCCTGAGTAGGAGAAGGG - Intronic
985359598 4:189158640-189158662 TGAAACGTTCAGCAGGTGAATGG - Intergenic
986453759 5:7894080-7894102 GGAAAGGAGGAGTAGGTGAAAGG - Intronic
987325429 5:16807932-16807954 TGAAAGACTGAGTAAATGAAAGG - Intronic
988208581 5:28172847-28172869 TGAAAGCTTGAGTAGGCTGAGGG + Intergenic
989007630 5:36832952-36832974 TGGTAGGTTGAGTAAGTGAAAGG - Intergenic
991445053 5:66690696-66690718 TGAAAAATTGAGGAGGTGATTGG + Intronic
991919952 5:71646830-71646852 TGAAATCTTGAGGAGGAAAAGGG - Intronic
994854721 5:105102698-105102720 TTAAAGGTTGAGGAGCTGAAGGG - Intergenic
996156712 5:120111552-120111574 TTAAGGCTTGAGGAGGAGAAAGG + Intergenic
997615380 5:135242616-135242638 TGAAGGCGTGAATAGGTGAATGG + Intronic
998375512 5:141688040-141688062 TGAAAGCAGGGGTAGGTGCAAGG + Intergenic
998526567 5:142848072-142848094 GGCAAGCTTTAGTTGGTGAAGGG + Intronic
999045513 5:148464828-148464850 AGAAATTTTTAGTAGGTGAATGG + Intronic
1000382654 5:160642924-160642946 AGAAACCTTGAGTAGGTGATGGG - Intronic
1000540154 5:162529749-162529771 TGAAAGCTGGGGTGGGGGAAAGG - Intergenic
1000686244 5:164253511-164253533 ACAAAGCCTGAGAAGGTGAAGGG + Intergenic
1001048227 5:168392196-168392218 TGAAAGCACGAGTAAGTGAAGGG + Intronic
1001138543 5:169123266-169123288 ACAAAGCTTGAGTAGAAGAATGG + Intronic
1006920168 6:37622641-37622663 TGAATTCATGAGTAAGTGAATGG + Intergenic
1007095617 6:39210975-39210997 GGAAAGGTGGAGTAGGGGAAGGG - Intronic
1008385654 6:50886882-50886904 TTAAAGATTGGGTAGGTTAAAGG + Intergenic
1008449795 6:51637266-51637288 TGTAAGCTTGAGTTTTTGAATGG - Intronic
1009350828 6:62676711-62676733 TCAAAGTTTGAGTGGGTGAAAGG - Intergenic
1015346503 6:132165682-132165704 TGAAAGATTAAGTATGTGACCGG - Intergenic
1016712844 6:147193134-147193156 CAAAAACTTGACTAGGTGAAAGG + Intergenic
1019079790 6:169422474-169422496 TGAAGGCCTGAGTGCGTGAACGG + Intergenic
1021044470 7:15905822-15905844 TCAAAGCTTGAACATGTGAAAGG - Intergenic
1022098350 7:27154727-27154749 TGGGAGCTGGAGTAGGTGATGGG + Exonic
1022828060 7:34036831-34036853 GGAAAGCCTGAGTTGGTGGAAGG + Intronic
1026531249 7:71199425-71199447 TGAATGGATGAGTAGGTGAGTGG - Intronic
1026873345 7:73866490-73866512 TGAATGGGTGAGTGGGTGAATGG - Intergenic
1027224971 7:76237992-76238014 TGAGAGCTTGGGTGGGGGAAGGG - Intronic
1027886057 7:83906702-83906724 TTAAATCATAAGTAGGTGAAAGG - Intergenic
1028248229 7:88508740-88508762 TGAAATCTTGAGAAGGAGGATGG + Intergenic
1028501562 7:91524614-91524636 TGAATCCTTAAGTAGATGAATGG - Intergenic
1028906743 7:96163009-96163031 TGAAACCTTCACAAGGTGAAGGG + Intronic
1029072813 7:97913881-97913903 TGAATGGTTGAGTCGGTGAAGGG + Intergenic
1030720801 7:112868419-112868441 TGAAAGCCCCAGTATGTGAAAGG + Intronic
1030980465 7:116180167-116180189 TGAAAGTATGATTTGGTGAATGG + Intergenic
1031430277 7:121659500-121659522 AGAAACCTTCAGTAGGTGAATGG - Intergenic
1033024904 7:137762708-137762730 TGAAAGCTTGAGGTGGGTAAGGG - Intronic
1033428082 7:141263513-141263535 TGAAGGCTGGGGTAGGGGAAAGG + Intronic
1034459315 7:151189749-151189771 TGAAAGCAAAAGTAGATGAATGG - Intergenic
1035452625 7:158988091-158988113 TGGATGCATGAATAGGTGAATGG - Intergenic
1036237355 8:7051829-7051851 TGAAGGCTTGAATAGGGAAAAGG + Intergenic
1036706775 8:11052517-11052539 TGAATGGGTGAGTTGGTGAAGGG + Intronic
1036738380 8:11339866-11339888 TGCAAGCTTGAATAAGTTAATGG - Intergenic
1038014811 8:23505325-23505347 TGAAAGATCTGGTAGGTGAAGGG + Intergenic
1038395980 8:27245728-27245750 TGGAAGCCTGAATAGGTGGAGGG + Intronic
1038574429 8:28692318-28692340 TGAAGGCTTGGGTTGGGGAAGGG + Intronic
1039151450 8:34511441-34511463 TAAAAGCTAGTGTAGTTGAAAGG - Intergenic
1040931865 8:52743754-52743776 TGTAACCTTGAGTAGGGTAAGGG - Intronic
1041043782 8:53872547-53872569 TGAAAGAATGAGTAAGTGAGTGG + Intronic
1041326588 8:56672864-56672886 TGAATGATTGAGGAGCTGAAAGG - Intergenic
1042200499 8:66276003-66276025 TGACAGCTTGAAGAGGCGAAGGG - Intergenic
1043235905 8:77866133-77866155 TGAAAGCCTGAATAGGTCAAAGG - Intergenic
1044379628 8:91519098-91519120 TGAAAGCTAGAGGGGATGAAAGG + Intergenic
1044946557 8:97395065-97395087 TCAAAGCTTGAGTTAGAGAAGGG + Intergenic
1045369030 8:101502699-101502721 GAAAACCTTAAGTAGGTGAAAGG + Intronic
1045529748 8:102973342-102973364 TGGCAGCTGGAGTAAGTGAAGGG - Intronic
1048994185 8:139781261-139781283 AGCAACCTTCAGTAGGTGAATGG + Intronic
1050084359 9:1949255-1949277 TGAAAGCAAGAGTAAGAGAAAGG - Intergenic
1050733544 9:8736912-8736934 TGAAAGCGGGAGGAGGGGAATGG - Intronic
1052488049 9:29127944-29127966 GAAAAGATTGAGTAGGAGAAGGG - Intergenic
1054465074 9:65488453-65488475 TGAATGCATTGGTAGGTGAATGG - Intergenic
1055007808 9:71528565-71528587 TGAAAGAGTGAGTAGACGAATGG + Intergenic
1055036453 9:71823449-71823471 TCAAACCTTGAGAAGGGGAAAGG + Intergenic
1055423174 9:76164992-76165014 AGAAAGATTGAGAAGGAGAAAGG - Intronic
1057957134 9:99419363-99419385 TGAAAGCCTAAGTAAGAGAAAGG - Intergenic
1058512558 9:105736210-105736232 TGAAAGCTACAGAAGGAGAAGGG - Intronic
1059923001 9:119178913-119178935 TGAAAGTTTGAGCCTGTGAAGGG + Intronic
1061218015 9:129232930-129232952 TGAATGAATGAGTAGGTGGATGG - Intergenic
1062089702 9:134669044-134669066 TGGAAGGATGAGTAGATGAATGG - Intronic
1186284283 X:8027126-8027148 TGGAAGGATGAGTAGGTGGATGG - Intergenic
1187310189 X:18134373-18134395 TGAAAGCTTAATTAGGTCATTGG - Intergenic
1188052396 X:25503699-25503721 TTACAGCTTGAATAGGTGAAGGG - Intergenic
1188255501 X:27957495-27957517 TGAAAAGATGAGTAGGTTAATGG + Intergenic
1188277191 X:28215031-28215053 TGAAAGCCTGTGTAAGAGAAAGG + Intergenic
1189618197 X:42807226-42807248 TGAAAGATTGATTACCTGAATGG - Intergenic
1190594569 X:52040155-52040177 TGAAAGACAGAGTAGCTGAAAGG + Intergenic
1192200764 X:69065344-69065366 TAAAAGCTTGGGTAAGTCAATGG + Intergenic
1193328755 X:80213264-80213286 TCAAGGCTTGAGTAGGTAGAGGG + Intergenic
1195974153 X:110507710-110507732 CCAAAACTTCAGTAGGTGAATGG + Intergenic
1196149742 X:112360132-112360154 TGAAAGGATGAGTAAGTGATGGG - Intergenic
1198895959 X:141454688-141454710 TGGAAGCTTGGGCAGGAGAATGG + Intergenic
1200695471 Y:6354850-6354872 TGAAAGCTAGAGTAAGCCAAGGG - Intergenic
1201039806 Y:9819860-9819882 TGAAAGCTAGAGTAAGCCAAGGG + Intergenic
1201277752 Y:12314455-12314477 TGAAAGCTTCAGAAGTTGGAAGG + Intergenic
1201357641 Y:13113762-13113784 TGAAAGCTTCAGAAGTTGGAAGG + Intergenic
1202052641 Y:20796981-20797003 TGAAAGCTTCAGAAGTTGGAAGG - Intergenic