ID: 975836409

View in Genome Browser
Species Human (GRCh38)
Location 4:78426833-78426855
Sequence ACTAGCTATCACTTGGGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 114}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975836409 Original CRISPR ACTAGCTATCACTTGGGTGC AGG (reversed) Intronic
902671353 1:17976414-17976436 CCTGGCTACCACTTGGCTGCAGG + Intergenic
908161783 1:61416510-61416532 AGTAGCTATTAGTTGGTTGCAGG + Intronic
910225878 1:84935480-84935502 ACTAGCTATCTATTGGATGCTGG - Intronic
912420589 1:109539916-109539938 AGGAGCTATCACATGGGAGCCGG + Exonic
921219834 1:212965579-212965601 ACTAGCTACCTTCTGGGTGCTGG + Intronic
1063267818 10:4473865-4473887 ACTATCTATAACTTAGGTGATGG - Intergenic
1067617215 10:47765036-47765058 ACTAGCCATCTCTCGGTTGCCGG + Intergenic
1068298356 10:55105948-55105970 ACTAGCTCTCTTTTAGGTGCAGG + Intronic
1068828721 10:61468927-61468949 ACTAGCTATCACTAGGAAACCGG + Intergenic
1070919840 10:80177660-80177682 ACTAGGCATCATGTGGGTGCAGG + Intronic
1072743582 10:97924706-97924728 AATAGCTACCACTTTGGTGGGGG - Intronic
1073529407 10:104217528-104217550 ACTAGCAAAGACATGGGTGCCGG - Intronic
1075611005 10:123854614-123854636 CCGAGCCATCACTTGGGTGCTGG - Intronic
1077324985 11:1959810-1959832 ACTTGCTATCTCTTGGGTCAGGG - Intronic
1079334618 11:19560326-19560348 ACAAGTTCTCACTGGGGTGCGGG + Intronic
1080656361 11:34261777-34261799 ACTGGCTATGCCTTGGGTGGGGG - Intronic
1083420944 11:62552964-62552986 ACCAGCTTTAACTTGGGTTCTGG - Intronic
1202807967 11_KI270721v1_random:14989-15011 ACTTGCTATCTCTTGGGTCAGGG - Intergenic
1093633557 12:21437991-21438013 ACTAGCTTTCTCTTAGGCGCAGG + Intronic
1098330312 12:69345885-69345907 ACATGCTATCACTTTGGTTCAGG + Intergenic
1100675690 12:96864313-96864335 ATTACCTATCACTTAGCTGCTGG - Intronic
1109432698 13:62256192-62256214 ATTAGATATCACCTGGGTGATGG + Intergenic
1111526981 13:89484672-89484694 ATTAGCTGGCACTTGGGTTCAGG + Intergenic
1118943603 14:70361576-70361598 ATTAGCTACTACTTAGGTGCCGG - Intronic
1121817102 14:96936964-96936986 ACTAGAGAACACTTGGGTGTAGG + Intergenic
1122483845 14:102065191-102065213 ATTAGCTGTCTCTTGGCTGCCGG + Intergenic
1128672683 15:69586300-69586322 ACTAGCTCTCATATGGGGGCTGG - Intergenic
1129625520 15:77194230-77194252 TCTAGCTATAACTTGAGTCCTGG + Intronic
1131508455 15:93035865-93035887 CCTAGCTATCAACTGGGTGCAGG - Intronic
1137343220 16:47630627-47630649 ATTAACAATCACATGGGTGCAGG - Intronic
1137889146 16:52140205-52140227 ACTAGCTATAACTTTGGTTCAGG - Intergenic
1150695486 17:67401362-67401384 ACCAGCCATCGCTTGGGTGTGGG + Intronic
1152397507 17:80043322-80043344 AGAAGTTATCACTTGGGTGCTGG + Intronic
1157511207 18:48276232-48276254 AATAGCTATAACTGGGCTGCAGG + Intronic
1162824492 19:13243312-13243334 AGTGTGTATCACTTGGGTGCGGG + Intronic
1164062539 19:21688258-21688280 ACTAGCCATCTCTTGGTCGCCGG - Intergenic
1164533718 19:29068068-29068090 ACTGGCTCTCAGCTGGGTGCTGG + Intergenic
925085726 2:1106023-1106045 ACGTGCTGTCACTCGGGTGCAGG + Intronic
925085734 2:1106075-1106097 ACCTGCTGTCACTCGGGTGCAGG + Intronic
925085743 2:1106127-1106149 ACCTGCTGTCACTCGGGTGCAGG + Intronic
925085789 2:1106438-1106460 ACGTGCTGTCACTCGGGTGCAGG + Intronic
925085797 2:1106490-1106512 ACGTGCTGTCACTCGGGTGCAGG + Intronic
925085805 2:1106542-1106564 ACGTGCTGTCACTCGGGTGCAGG + Intronic
925085813 2:1106594-1106616 ACGTGCTGTCACTTGGGTGCAGG + Intronic
925085821 2:1106646-1106668 ACACGCTGTCACTCGGGTGCAGG + Intronic
925085836 2:1106750-1106772 ACGTGCTGTCACTCGGGTGCAGG + Intronic
925085844 2:1106802-1106824 ACGTGCTGTCACTCGGGTGCAGG + Intronic
925085852 2:1106854-1106876 ACGTGCTGTCACTCGGGTGCAGG + Intronic
925085859 2:1106906-1106928 ACGTGCTGTCACTCGGGTGCAGG + Intronic
925085866 2:1106958-1106980 ACGTGCTGTCACTCGGGTGCAGG + Intronic
925085874 2:1107010-1107032 ACGTGCTGTCACTCGGGTGCAGG + Intronic
925085881 2:1107062-1107084 ACGTGCTGTCACTCGGGTGCAGG + Intronic
925085889 2:1107114-1107136 ACGTGCTGTCACTCGGGTGCAGG + Intronic
925085896 2:1107166-1107188 ACGTGCTGTCACTCGGGTGCAGG + Intronic
925085904 2:1107218-1107240 ACGTGCTGTCACTCGGGTGCAGG + Intronic
925085912 2:1107270-1107292 ACGTGCTGTCACTCGGGTGCAGG + Intronic
925085920 2:1107322-1107344 ACGTGCTGTCACTCGGGTGCAGG + Intronic
925085927 2:1107374-1107396 ACGTGCTGTCACTCGGGTGCAGG + Intronic
925085935 2:1107426-1107448 ACGTGCTGTCACTCGGGTGCAGG + Intronic
925085943 2:1107478-1107500 ACGTGCTGTCACTCGGGTGCAGG + Intronic
925085950 2:1107530-1107552 ACGTGCTGTCACTCGGGTGCAGG + Intronic
925085957 2:1107582-1107604 ACGTGCTGTCACTCGGGTGCAGG + Intronic
925085965 2:1107634-1107656 ACGTGCTGTCACTCGGGTGCAGG + Intronic
925085972 2:1107686-1107708 ACGTGCTGTCACTCGGGTGCAGG + Intronic
925085980 2:1107738-1107760 ACGTGCTGTCACTCGGGTGCAGG + Intronic
925085988 2:1107790-1107812 ACGTGCTGTCACTCGGGTGCAGG + Intronic
925085996 2:1107842-1107864 ACGTGCTGTCACTCGGGTGCAGG + Intronic
925086003 2:1107894-1107916 ACGTGCTGTCACTCGGGTGCAGG + Intronic
925086011 2:1107946-1107968 ACGTGCTGTCACTCGGGTGCAGG + Intronic
925086019 2:1107998-1108020 ACGTGCTGTCACTCGGGTGCAGG + Intronic
925086027 2:1108050-1108072 ACGTGCTGTCACTCGGGTGCAGG + Intronic
925086035 2:1108102-1108124 ACGTGCTGTCACTCGGGTGCAGG + Intronic
925086043 2:1108154-1108176 ACGTGCTGTCACTCGGGTGCAGG + Intronic
925086050 2:1108206-1108228 ACGTGCTGTCACTCGGGTGCAGG + Intronic
925086058 2:1108258-1108280 ACGTGCTGTCACTCGGGTGCAGG + Intronic
925086066 2:1108310-1108332 ACGTGCTGTCACTCGGGTGCAGG + Intronic
925086074 2:1108362-1108384 ACGTGCTGTCACTCGGGTGCAGG + Intronic
925086081 2:1108414-1108436 ACGTGCTGTCACTCGGGTGCAGG + Intronic
925086089 2:1108466-1108488 ACGTGCTGTCACTCGGGTGCAGG + Intronic
925086096 2:1108518-1108540 ACGTGCTGTCACTCGGGTGCAGG + Intronic
925086104 2:1108570-1108592 ACGTGCTGTCACTCGGGTGCAGG + Intronic
925086111 2:1108622-1108644 ACGTGCTGTCACTCGGGTGCAGG + Intronic
925086119 2:1108674-1108696 ACGTGCTGTCACTCGGGTGCAGG + Intronic
925086127 2:1108726-1108748 ACGTGCTGTCACTCGGGTGCAGG + Intronic
925086135 2:1108778-1108800 ACGTGCTGTCACTCGGGTGCAGG + Intronic
925086142 2:1108830-1108852 ACGTGCTGTCACTCGGGTGCAGG + Intronic
925086150 2:1108882-1108904 ACGTGCTGTCACTCGGGTGCAGG + Intronic
925086158 2:1108934-1108956 ACGTGCTGTCACTCGGGTGCAGG + Intronic
925086166 2:1108986-1109008 ACATGCTGTCACTCGGGTGCAGG + Intronic
925086173 2:1109038-1109060 ACGTGCTGTCACTCGGGTGCAGG + Intronic
926640093 2:15225956-15225978 ACTGGGTATCACTTGGGAGCTGG + Intronic
934128046 2:88917551-88917573 AGTAGTTATCACTTGGTTGCTGG - Intergenic
937277087 2:120691961-120691983 AATAGCCATCAATAGGGTGCTGG + Intergenic
940068440 2:149655754-149655776 AGTGGGTATCACATGGGTGCAGG + Intergenic
1170705667 20:18742744-18742766 AGTAGCTCTCAATTGGGTCCAGG - Intronic
1172397109 20:34615997-34616019 ATTAAATGTCACTTGGGTGCTGG + Intronic
1173296218 20:41760647-41760669 AATAGCTAACACTTAAGTGCAGG - Intergenic
1182655848 22:31889123-31889145 CCTAGCTATGACCTGGGTGAAGG + Intronic
950536358 3:13581247-13581269 ACTGGCTTTCACTGGGGTCCAGG + Intronic
954165535 3:48754480-48754502 TCAAGCTATCACATGGGCGCCGG + Intronic
957332754 3:78787572-78787594 ACAAGCTATCACCTATGTGCGGG + Intronic
959914632 3:111802887-111802909 ATTATCTATCATTTGGGAGCAGG - Intronic
970438118 4:16055381-16055403 ACCAGCTCTCATTTGGCTGCAGG + Intronic
975836409 4:78426833-78426855 ACTAGCTATCACTTGGGTGCAGG - Intronic
977244499 4:94614892-94614914 ACTATGGATCACTTGGGTGCAGG - Intronic
977890050 4:102299148-102299170 ACTGGCTATCACTTGGGAAGTGG - Intronic
980266072 4:130517556-130517578 TCTAGCTTTCACTTCAGTGCTGG - Intergenic
987560386 5:19512046-19512068 TTTAGCTATGACTTGGATGCAGG - Intronic
1001512941 5:172336518-172336540 ACCCCCTATCACGTGGGTGCTGG - Exonic
1010555773 6:77277476-77277498 ACTAGATCTTTCTTGGGTGCAGG - Intergenic
1016891782 6:149014600-149014622 GCTAGCGCTCACTTGGGTCCAGG - Intronic
1022376272 7:29814343-29814365 ACAAGCTATCATTTGTGGGCAGG + Intronic
1022862933 7:34386754-34386776 ACTAGGTAACACTAGGGTTCTGG - Intergenic
1024540697 7:50473220-50473242 TCTTTCTATCCCTTGGGTGCAGG - Intronic
1033640285 7:143256705-143256727 CCTGGCTATCACTCTGGTGCTGG + Intronic
1038407289 8:27331487-27331509 ACAAAGTCTCACTTGGGTGCAGG + Intronic
1038498858 8:28026718-28026740 GCTTGCTGTCAGTTGGGTGCTGG + Intronic
1040375061 8:46817044-46817066 AATTCATATCACTTGGGTGCTGG - Intergenic
1040632265 8:49229326-49229348 ACTATCTGTCATTTGGGTTCTGG - Intergenic
1048342205 8:133548853-133548875 ACTGGCTATCATATGGGTGTAGG + Intronic
1050362088 9:4839871-4839893 TGGAGCTAACACTTGGGTGCCGG + Intronic
1058949931 9:109893866-109893888 AGTAGCTAACACTTAGGTGGTGG + Intronic
1062039254 9:134396584-134396606 ACCAGCTCTCATCTGGGTGCTGG + Intronic
1190413058 X:50156146-50156168 ACTAGCTATCCCTATGGTGTCGG + Intergenic