ID: 975836440

View in Genome Browser
Species Human (GRCh38)
Location 4:78427102-78427124
Sequence ACAAGGTAATTGAAACCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975836434_975836440 11 Left 975836434 4:78427068-78427090 CCTCAATGTGGCAGTATTGAGAG 0: 69
1: 200
2: 284
3: 568
4: 1340
Right 975836440 4:78427102-78427124 ACAAGGTAATTGAAACCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975836440 Original CRISPR ACAAGGTAATTGAAACCTGA AGG Intronic
No off target data available for this crispr