ID: 975839068

View in Genome Browser
Species Human (GRCh38)
Location 4:78455095-78455117
Sequence CAGAGCAAAGAGAAGAGGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 797
Summary {0: 1, 1: 0, 2: 5, 3: 53, 4: 738}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975839068_975839073 -5 Left 975839068 4:78455095-78455117 CCAGTCCTCTTCTCTTTGCTCTG 0: 1
1: 0
2: 5
3: 53
4: 738
Right 975839073 4:78455113-78455135 CTCTGAGGGGCCCCTCCCCGTGG 0: 1
1: 0
2: 1
3: 18
4: 187
975839068_975839077 7 Left 975839068 4:78455095-78455117 CCAGTCCTCTTCTCTTTGCTCTG 0: 1
1: 0
2: 5
3: 53
4: 738
Right 975839077 4:78455125-78455147 CCTCCCCGTGGCTAATAAAACGG 0: 1
1: 0
2: 0
3: 10
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975839068 Original CRISPR CAGAGCAAAGAGAAGAGGAC TGG (reversed) Intronic
900829321 1:4953867-4953889 TACAGCAAAGAGAAGAGAAATGG + Intergenic
900837216 1:5014207-5014229 TGGAGCACAGAGAACAGGACAGG - Intergenic
901173720 1:7283471-7283493 TGGAGCCCAGAGAAGAGGACTGG - Intronic
901192391 1:7420313-7420335 CAGAGCAAGGAGCAGGGCACTGG - Intronic
901212596 1:7534943-7534965 CAGAGGGAAGGGAAGAGGAGGGG + Intronic
901232320 1:7648095-7648117 GAGAGAGAAGAGAAGAGGGCTGG + Intronic
901233142 1:7652307-7652329 CAGAGCAAGCAGGAGAGGAAGGG - Intronic
901563294 1:10090425-10090447 CAGAGCAAAGAGTAAAACACAGG - Intronic
901732335 1:11289248-11289270 CGGAGCAAAGGGCAGAGGACAGG - Intronic
901783931 1:11612178-11612200 CAGAGGAGAGAGAAGAAGACAGG + Intergenic
902980347 1:20118199-20118221 TAGGGCAAAAAAAAGAGGACCGG - Intronic
902992668 1:20200102-20200124 CTGAGCAAAGATATGAGAACAGG - Intergenic
903322801 1:22552844-22552866 CAGAGCAGAGAAGAAAGGACAGG + Intergenic
903454933 1:23481026-23481048 AAAAGGAAAGAGAACAGGACCGG + Intronic
903828903 1:26163303-26163325 AAGAGCAGAGAGAAAAGGAACGG - Intergenic
904241441 1:29148828-29148850 AAGAGCAAGGACAAGAGGAAGGG - Exonic
905022815 1:34829463-34829485 CATAGCCAAGAGAACAGGCCTGG + Intronic
905342412 1:37288304-37288326 GGGAGCAAAGAGAATGGGACAGG + Intergenic
905476558 1:38232818-38232840 AACAGGAAAGAGAAGAGGTCAGG - Intergenic
906127383 1:43435454-43435476 GAGAGCAAGGAGGATAGGACAGG + Intronic
906717921 1:47984178-47984200 CGGTGCAAAGATAAAAGGACAGG - Intronic
906794614 1:48687214-48687236 CAAGGGAAAGAGAAGAGGAGGGG + Intronic
907138068 1:52157998-52158020 CATAGCAGAGAGCAGAGGACAGG - Intronic
907378070 1:54060642-54060664 AAGAGGTAAGAGAAGAGGCCTGG + Intronic
907386326 1:54127934-54127956 CAGAGCAGGGTGAAGAGGAACGG - Intergenic
907480477 1:54742450-54742472 CACAGCAGAGGGAAGAGCACAGG - Exonic
908018071 1:59867450-59867472 TAGAGGAAAAAGAAGAAGACTGG - Intronic
908082797 1:60598602-60598624 GGGAGGAGAGAGAAGAGGACGGG + Intergenic
909165617 1:72220414-72220436 AAGAGGGAAGAGAAGAGGAGAGG - Intronic
909952034 1:81732011-81732033 CAGAGAAAAGAAAAAGGGACAGG - Intronic
910859514 1:91730234-91730256 CAGAGGAAACAGACGAGGACAGG - Intronic
910921393 1:92351566-92351588 AAGAGCAAAGGGAAGAGGGAAGG - Intronic
911035051 1:93533631-93533653 CAGTGGCAAGAGAAGAGAACTGG + Intronic
911195157 1:94987138-94987160 CAGAGCCGAGAGATGAAGACAGG + Intronic
912413551 1:109493648-109493670 AAGAGCAAGGAGAATAGGAAAGG - Intergenic
912414431 1:109498410-109498432 CAGAGCAGAGAGGAGGGCACTGG + Intronic
912510489 1:110186457-110186479 AAAAGGAAAGAGAAGAGGAAAGG + Intronic
912758724 1:112346947-112346969 CAGAGAAAAGGGAAAAAGACTGG + Intergenic
913184828 1:116360863-116360885 GAGAACAAAGAGAATAGGACGGG + Intergenic
915785722 1:158609294-158609316 TAGAGCTCAGAGAAGAGAACAGG + Intergenic
916206506 1:162320474-162320496 TTGAGAAAAGAGAAGAGGAAGGG + Intronic
916401488 1:164453700-164453722 AAGAGAAAAGAGGAGAGGAGAGG + Intergenic
916401491 1:164453730-164453752 AAGAGAAAAGAGGAGAGGAGAGG + Intergenic
916451785 1:164927940-164927962 AAGAGAAAAGGGAAGAGGCCGGG - Intergenic
917685795 1:177414501-177414523 CAGAGAAAGGAGCAGAGGAAGGG + Intergenic
918128109 1:181602028-181602050 CCGAGTAAAGACCAGAGGACGGG - Intronic
918307914 1:183264010-183264032 GAGAGAAAAGAAAGGAGGACAGG + Intronic
918401673 1:184169126-184169148 CTGAGCAAAGAGAACAAAACTGG - Intergenic
918522015 1:185425008-185425030 CACATTAAAGAGAAGAGCACAGG + Intergenic
919377484 1:196812684-196812706 CTGAGCAAAGAAATGAGAACAGG - Intergenic
919386998 1:196934582-196934604 CTGAGCAAAGAAATGAGAACAGG - Intronic
919389775 1:196968584-196968606 CTGAGCAAAGAAATGAGAACAGG - Intergenic
919660868 1:200244682-200244704 AAGAGCACAGAGAAGATTACTGG + Intergenic
920039102 1:203084538-203084560 GAGACCCAAGGGAAGAGGACCGG + Intronic
920129531 1:203721158-203721180 CAGAGAAAAGCTAAAAGGACTGG + Intronic
920261581 1:204691874-204691896 CAGTACAAAGAGAAAAGAACAGG - Intergenic
920503667 1:206501389-206501411 CAGAGCACAGAGGAGGAGACAGG + Intergenic
920553331 1:206884136-206884158 CAAAGCACAGAGAAGAGAGCTGG - Intergenic
921002826 1:211062015-211062037 CTGAGCAAAAAGAACAGAACTGG + Intronic
921080520 1:211735518-211735540 CAGAACAAAGAAAAGGGGAGGGG - Intergenic
921211756 1:212906756-212906778 GAGACCAAAGAGAAGAGAATTGG + Intergenic
921251863 1:213305617-213305639 CAGAACACAGAGTAGAGGAGTGG + Intergenic
921472616 1:215567403-215567425 CGGAGCACGGAGAAGAGGCCCGG + Exonic
921671350 1:217927265-217927287 GAGAGCAAAGAGAAGGAGAGTGG + Intergenic
922149949 1:222992051-222992073 GAGAGAAAAGAGAAGTTGACTGG + Exonic
922362588 1:224837042-224837064 GAGAGGAAAAAGGAGAGGACAGG - Intergenic
922651943 1:227348229-227348251 TAGAAGAAAGAGAAGAGGAGAGG - Intergenic
923947734 1:238907843-238907865 CCGTGCAAAGAGAAGAGAATCGG - Intergenic
924069484 1:240261698-240261720 CAGAGAGGAGAGAAGAGGTCAGG + Intronic
924381716 1:243471494-243471516 GAGAGGACACAGAAGAGGACTGG - Intronic
1063102934 10:2966265-2966287 AAAAGAAAAGAGAAGAGGAGAGG + Intergenic
1063649059 10:7915268-7915290 AAGAGCAAAGGGAAGAGCGCAGG - Intronic
1063860483 10:10302053-10302075 CAGAGCAAAGAGAAGTATACAGG - Intergenic
1065082272 10:22140313-22140335 CAGAGGAAAGGGAAGAGTGCAGG + Intergenic
1065283546 10:24165099-24165121 TAAAGCAAAGAGAAGTGGCCAGG + Intronic
1065547698 10:26838408-26838430 AAGAGGAAGGAGCAGAGGACAGG + Intronic
1065784916 10:29204053-29204075 CAGAGAAAAGCGAAGAGCCCCGG - Intergenic
1065797282 10:29319124-29319146 AAGAGAAAAAAGAAGAGGAAAGG + Intergenic
1065859887 10:29863672-29863694 TAGAACAAAGAAAAGATGACTGG + Intergenic
1065945878 10:30605230-30605252 AAGAGAAAAAAGAAGAGGAAAGG - Intergenic
1065952375 10:30663922-30663944 CAGAGAAAAGAGATGAGGGAAGG - Intergenic
1066334512 10:34462865-34462887 AAGAGGAAAGAGAAGGGGAAGGG + Intronic
1066485582 10:35840103-35840125 CTGAGCAAAAAGAACAGAACAGG - Intergenic
1066521662 10:36226699-36226721 CACACCAAAGAGGAAAGGACAGG - Intergenic
1067251421 10:44589980-44590002 CACAGCCCAGAGAAGAGGGCCGG + Intergenic
1067727994 10:48787445-48787467 CAGAGCAATGGGACGAGGTCAGG + Intronic
1067838538 10:49657003-49657025 CAGGGCAAAGAGAACAGGAAAGG + Intronic
1068078394 10:52287808-52287830 CTGAGCAGAGAGAAAAGGATAGG + Intronic
1068420742 10:56788994-56789016 CAGAAAAAAGAAAAGAGGCCAGG - Intergenic
1068934822 10:62625337-62625359 CAGAGCAGTGGGAAGAGCACTGG - Intronic
1069273598 10:66561983-66562005 CAGAGAAGAGAGAAGATAACAGG + Intronic
1069696135 10:70386958-70386980 AAAAGAAAAGAGAAGAGGCCGGG + Intergenic
1069740154 10:70682208-70682230 CAGAAGAAAGAGAAGAGGACCGG + Intronic
1070183517 10:74037685-74037707 CCAAACAAAGAGAAGAGCACAGG - Intronic
1070278202 10:75028605-75028627 CAAAACAAAGAGAGGAAGACCGG + Exonic
1070696564 10:78568297-78568319 CAGAAGCAAGAGAAGAGGAAGGG - Intergenic
1071305356 10:84294687-84294709 CAGCCCAAACAGAAGGGGACAGG + Intergenic
1071407731 10:85355452-85355474 GAGAGCAAAGAAAGGAGGAGGGG - Intergenic
1071503516 10:86219543-86219565 CAGAGCAGGGAGAAGGGGAGCGG - Intronic
1071522660 10:86340785-86340807 CAGAGCAACTGGATGAGGACTGG + Intronic
1072059290 10:91793827-91793849 CTGAGCAAAAAGAATAAGACTGG + Intergenic
1072223598 10:93348155-93348177 CAGAGCACAGGGAAGAGTATAGG - Intronic
1072268445 10:93752642-93752664 CAGAGCAGAGAGAACAGGCTGGG - Intergenic
1072329111 10:94328542-94328564 CACAACTAAGAGAAGAGAACTGG + Exonic
1072771882 10:98147850-98147872 CTGAGCAAAAAGAAGAAAACTGG - Intronic
1073028811 10:100508479-100508501 CAGAAGAAAGAGAAAAGGCCAGG + Intronic
1073350028 10:102813002-102813024 GACAGCAAAGAGAAGACGCCTGG + Exonic
1073387936 10:103143015-103143037 AAGAGAAAAGAAAAGAGGAAAGG + Intronic
1074006743 10:109433485-109433507 CTGAGCACAGAGAATAGGATTGG - Intergenic
1074155018 10:110790376-110790398 GAGAGCAAAGAGGAGGAGACAGG + Intronic
1074284047 10:112081141-112081163 AAGAGAAAAGAGAAAAGGAAAGG + Intergenic
1074298436 10:112211984-112212006 CTGAGAGAAGAGAAGAGGAAGGG + Intronic
1074596353 10:114871456-114871478 CAGAACAAAGGGAAGAGGCTGGG - Intronic
1074665706 10:115721071-115721093 AAGGGCAAATAGATGAGGACTGG - Intronic
1074702012 10:116100805-116100827 CAGAGCAAAGAACCGAGGGCCGG + Intronic
1075107257 10:119548506-119548528 CAGACCACAGAGAAGAGGACAGG + Intergenic
1075512910 10:123086788-123086810 GAGATCAGAGAGAGGAGGACAGG - Intergenic
1075602596 10:123781355-123781377 CAGGGCAGAGAGGAGAGGACAGG + Intronic
1075626425 10:123967412-123967434 CAGAGCCAAGAGTTGAGGCCAGG + Intergenic
1076069149 10:127472232-127472254 CAAAGGAGAGAGATGAGGACAGG + Intergenic
1076923142 10:133465940-133465962 CAGAGCACAGAGAATGGGAGTGG - Intergenic
1077815002 11:5678438-5678460 CAGAGATAAGAGAAGAGAAAGGG + Intronic
1077859653 11:6165267-6165289 CTGAGCAAAGAGAACAAAACTGG + Intergenic
1077866216 11:6223742-6223764 GCGAGAAAAGAGAAGAAGACGGG + Exonic
1078577232 11:12512849-12512871 GAGGGCACAGAGAAGAGGGCTGG - Intronic
1078628890 11:12983749-12983771 CAGAGCACAGAGTAGAGCAAAGG - Intergenic
1078654832 11:13229029-13229051 CAGAGCAAAGAGAAGGAGACTGG + Intergenic
1078874870 11:15383136-15383158 CAGAGCAAAGGGAACAGAATCGG + Intergenic
1079121695 11:17689804-17689826 CAGAGCAAGGAGGAGAGTAGAGG - Intergenic
1079492403 11:21003586-21003608 CAGAGTATAGAGAAGGAGACAGG - Intronic
1079633173 11:22702818-22702840 CAGAGCAAGGAGAAGAGATAGGG + Intronic
1079687258 11:23375250-23375272 CTGAGCAAAAAGAACAGTACTGG + Intergenic
1080122242 11:28691270-28691292 TAGAGTAAAGACAAGTGGACTGG + Intergenic
1080622263 11:33996711-33996733 CAGAGCAAAGTGCAGAGGTGGGG - Intergenic
1080849235 11:36053948-36053970 CAGGGCAAAGGGAAGAGTGCAGG - Intronic
1080889109 11:36393619-36393641 CAGAGCAAAAAGAACAAAACTGG - Intronic
1081250106 11:40819442-40819464 CAGAGTAAAGCCAGGAGGACTGG + Intronic
1081576234 11:44319984-44320006 CGGAGCAAAGAGGCGAGGCCCGG + Intergenic
1082094730 11:48120263-48120285 CAGCGTAAAGAGAAAAGGACTGG - Intronic
1082114147 11:48309509-48309531 CAAAGAAAAGAGTAGAGGCCAGG - Intergenic
1082657055 11:55869002-55869024 CTGAGCAAAGAGAAGGGGGTGGG + Intergenic
1083897046 11:65625195-65625217 CAGAAGACTGAGAAGAGGACAGG - Exonic
1083912652 11:65719292-65719314 CAGCTCAAAAAGGAGAGGACAGG + Exonic
1084313696 11:68331538-68331560 CGGAGCACACAGAACAGGACAGG - Intronic
1084364846 11:68691078-68691100 CAAGGCAAAGAGAACAGGAATGG - Exonic
1084420040 11:69055882-69055904 CACCCCAAAGAGAAGAGGAGAGG + Intronic
1084693326 11:70739439-70739461 CAGGGGCAAGAGGAGAGGACGGG - Intronic
1084723889 11:70927852-70927874 TAGAACAAAGGGAAGAGGAAGGG + Intronic
1085026493 11:73239581-73239603 CAGATCTAGGAGCAGAGGACTGG + Intergenic
1085062756 11:73462923-73462945 AAGAGAAAAGAGAAGAGAAGAGG + Intronic
1085132339 11:74051482-74051504 CAGATCACAGAGAAAAGGAATGG + Intronic
1085454348 11:76657231-76657253 CTGAGCACAGAGAAGGGGAGGGG + Intergenic
1085540889 11:77268731-77268753 CACAGTAAAGAGAAATGGACTGG + Intronic
1085567147 11:77524550-77524572 CAGAGAACACAGAAGAGGGCAGG - Intronic
1085647682 11:78237680-78237702 CTGAGCAGAGAGAAAAGGATTGG + Intronic
1086069228 11:82781281-82781303 TAGAGCTCAGAGAAGAGGTCAGG + Intergenic
1086186682 11:84025906-84025928 AAGAAAAAAGAGAAGAGGAGAGG + Intronic
1086526217 11:87729163-87729185 CAGAGACAAGGGAAGAGGAGGGG - Intergenic
1086595899 11:88570035-88570057 CAAAGGAAAGAGAAGGGGAAGGG + Intronic
1086874621 11:92080444-92080466 CTGAGCAAAAAGAACAAGACTGG + Intergenic
1088174033 11:107030767-107030789 CAGAGGAAAGAGAGAAAGACAGG + Intergenic
1088483539 11:110319525-110319547 CAGTGCTAAGATAAGATGACAGG + Intergenic
1088560353 11:111109047-111109069 TAGTGCAGAGAGAAGAGAACAGG + Intergenic
1088618454 11:111657840-111657862 TAGAGCAAATGGAAGAGGAAAGG + Intronic
1088680009 11:112231887-112231909 CAGAGACAGGAGAAGAGGAGGGG + Intronic
1088707545 11:112477428-112477450 CTGAGGAAAGGGAGGAGGACAGG - Intergenic
1088756203 11:112887289-112887311 AATACCAAAGAGAAGAGGATTGG + Intergenic
1088818263 11:113435770-113435792 CAGAGCCCAGAGAGGAGGAAGGG + Intronic
1089537461 11:119169321-119169343 CAGGGCAATGAGAAAAGGAGGGG - Intronic
1089704309 11:120266385-120266407 CAGGGGTAAGAGAAGAGGAAGGG - Intronic
1090416555 11:126544436-126544458 CAAAACAAAGAGAAGAGAACTGG - Intronic
1090480034 11:127059869-127059891 CAGAGGAAGGAGCAGGGGACAGG + Intergenic
1090566306 11:127995632-127995654 CAGAGAACAGAGAAGATGAGTGG - Intergenic
1091224490 11:133949564-133949586 GAGAGCAAAGAGGAGAGCAGAGG + Intronic
1091491879 12:939769-939791 CAAAGAAGAGAGAAGAGGGCTGG + Intronic
1091857638 12:3752494-3752516 CAGAGCAAAGGAAGGAGGTCAGG - Intronic
1092227476 12:6757237-6757259 AAGAGAAAAGAAAAGAGGAAAGG - Intronic
1093219135 12:16398409-16398431 AGGAGTAAAGAGAAGAGGAAGGG - Intronic
1094227682 12:28064442-28064464 CAGAGCAAAGAAAAAAAGAGGGG - Intergenic
1095982862 12:47982774-47982796 CTGAGCAGGGAGAAGAGGAGCGG - Intronic
1096100783 12:48969552-48969574 CACAGCACAGAGGAGGGGACTGG + Intronic
1097169923 12:57106886-57106908 CAGAGCAGAGAGTGGAGGCCAGG - Intronic
1097915251 12:65014172-65014194 GTGAGCAAAGCGAAGAGGTCAGG - Intergenic
1097921793 12:65083811-65083833 AAGAGAAAAGAGGAGAGGAAAGG - Intronic
1098028524 12:66230838-66230860 CTGAGCTAAGAGAAAAGGATGGG - Intronic
1098825161 12:75287568-75287590 CATAGAAAAGCCAAGAGGACAGG + Intronic
1098870808 12:75814989-75815011 CAGAGCACAGGCAAGAGAACTGG - Intergenic
1099040530 12:77648004-77648026 CACAACAAAGAGAAGAAAACAGG + Intergenic
1100035309 12:90243666-90243688 CAAAGAAAAGAGAAGAGAAGGGG - Intergenic
1100189080 12:92171296-92171318 GAAAGGAAAGGGAAGAGGACAGG + Intergenic
1100780690 12:98023032-98023054 AAGAGCAAACAGAAGAGGCAAGG - Intergenic
1101063496 12:100995848-100995870 GAGACCAAAGAGAACAGGAAAGG + Intronic
1101119226 12:101562004-101562026 CAGAGCAAAGGGTAGGGGCCTGG - Intergenic
1101968379 12:109296039-109296061 CAGAGAAAGGGGAAGAGGAGAGG - Intronic
1101975530 12:109354916-109354938 CAGAAGGAAGAGAAGAGAACAGG + Intronic
1102559041 12:113749113-113749135 CTGAGCAAAGGAAAGAGCACTGG - Intergenic
1102658301 12:114502367-114502389 CAGAGCAAAGAATAGTGGAGTGG + Intergenic
1102720312 12:115010317-115010339 TAGAGCATTGAGAAGAGGATAGG - Intergenic
1102794209 12:115674363-115674385 AAGAGAGAAGAGAAGAGGAGAGG - Intergenic
1103250503 12:119495985-119496007 CAGTGCAAAGAGGAGAGCAGGGG - Intronic
1103288715 12:119826071-119826093 AAGAAAAAAGAGAAGAGAACTGG + Intronic
1103520924 12:121536814-121536836 CACAGCAGAGAGGAGAGGACAGG + Intronic
1103802848 12:123550623-123550645 GAGAGCAATGAGAAAAGGATGGG - Intergenic
1103998956 12:124847991-124848013 CCCAGCAAAGAGAAAAGGGCTGG + Intronic
1104169301 12:126264697-126264719 CAGAGAAATGAGATGAGGACTGG - Intergenic
1104451875 12:128875876-128875898 CAGAGAAAGGAGAAGATGAGGGG - Intronic
1105870622 13:24502971-24502993 CAGAGGGAACAGCAGAGGACAGG + Intronic
1105917922 13:24934106-24934128 CAGAGGGAACAGGAGAGGACAGG - Intergenic
1105957326 13:25296184-25296206 CAGAGCAAAGGGAATTGGGCAGG + Intergenic
1106225463 13:27783042-27783064 CAGAGCAGAGTAGAGAGGACTGG - Intergenic
1106480993 13:30136685-30136707 CAGATCAGAGTGGAGAGGACAGG - Intergenic
1106519565 13:30484758-30484780 AAGAGGAAAGAGGAGAGGAGAGG + Intronic
1106579075 13:31002241-31002263 AAAAGCAAAGAGAAGAAGATAGG + Intergenic
1107958339 13:45538896-45538918 CAGAGAAGAGAGGAGAGGAGAGG - Intronic
1109081906 13:57914209-57914231 GAGAGCAAAGAGCAAAGGGCAGG + Intergenic
1109110427 13:58311590-58311612 GAGAGAAAACAAAAGAGGACAGG - Intergenic
1109610684 13:64761362-64761384 CAAAACAAAGACAAGAGGTCTGG + Intergenic
1110743622 13:79027023-79027045 CAAAGGAAAGAGCAGAGGAATGG - Intergenic
1111583198 13:90251297-90251319 CTGAGCAAAAAGAACAAGACTGG - Intergenic
1111592405 13:90367185-90367207 CAGAGAAAAGAAAAGAAGAGGGG + Intergenic
1111597050 13:90425739-90425761 CAAAGCAAATGAAAGAGGACAGG - Intergenic
1112155729 13:96815190-96815212 CAGACGAAAGAGAAGAGGCCTGG - Intronic
1112559802 13:100502888-100502910 CAGAGCAGACGGCAGAGGACAGG + Intronic
1112743296 13:102498742-102498764 CTGAGCAAAAAGAACAAGACTGG + Intergenic
1112845984 13:103644500-103644522 CTGAGCAAAAAGAACAAGACTGG - Intergenic
1112919384 13:104592716-104592738 GAGAGCAAACACAATAGGACTGG + Intergenic
1113437170 13:110302165-110302187 CAGAGGATAAAGAAGAGGAAAGG + Intronic
1114005708 14:18311172-18311194 TGGAGCACAGAGAAGAGGGCAGG - Intergenic
1114298435 14:21351805-21351827 ATGAGAAAAGAGAAGAGGAAGGG - Exonic
1114353319 14:21878731-21878753 CAGAGCAAACAGTAAAGGAGTGG - Intergenic
1114904909 14:27115352-27115374 CAAAGCAAAGCGTAGAGGAATGG - Intergenic
1115395842 14:32907375-32907397 CAGAACAAGGAGAAGAGTAGAGG - Intergenic
1115697742 14:35918945-35918967 CAGAGCAAGGTGGAGAGGATTGG - Intronic
1116110999 14:40581302-40581324 CAGTGAAAAGAGAAGATGATAGG - Intergenic
1116424917 14:44779178-44779200 CAAAGCCAAAAGAGGAGGACTGG + Intergenic
1116956873 14:50932980-50933002 CAGCTCAAAGAGAACAGGAATGG - Intronic
1117006845 14:51429063-51429085 AAGAGAAAAGAGAAGAGAACAGG + Intergenic
1117084453 14:52185040-52185062 CAGGACAAAGGGAGGAGGACAGG + Intergenic
1117213889 14:53529694-53529716 CAGAGCAAAGATCAGAGAGCTGG + Intergenic
1118508725 14:66445901-66445923 CAGGTAAATGAGAAGAGGACGGG - Intergenic
1119678782 14:76576291-76576313 CAGAGAGAAGAGCAGAGGAGAGG + Intergenic
1120015685 14:79470644-79470666 CAGGGATAAGGGAAGAGGACAGG + Intronic
1121156433 14:91689276-91689298 CAGAGCGGGGAGTAGAGGACTGG - Intronic
1121602773 14:95218421-95218443 CAGGGGAGAGAGGAGAGGACAGG + Intronic
1121687306 14:95846293-95846315 CAGGGGGAAGAGTAGAGGACTGG - Intergenic
1121877337 14:97465305-97465327 CAGATCAGAAGGAAGAGGACTGG + Intergenic
1121924861 14:97918273-97918295 ATGGGCACAGAGAAGAGGACTGG - Intergenic
1122522134 14:102352204-102352226 CACAGGAAAGAGCAGAGGATTGG - Intronic
1122705357 14:103617417-103617439 CAGGGCAATGTGAAGAGGGCTGG - Intronic
1122753820 14:103961183-103961205 CATAGCACTGAGAAGAGGAATGG + Intronic
1123479019 15:20614036-20614058 AAGTGGAAAGAGAAGAGGATCGG + Intergenic
1123638993 15:22386349-22386371 AAGTGGAAAGAGAAGAGGATCGG - Intergenic
1123702847 15:22928503-22928525 CAGAGCACAGAGCAAGGGACAGG + Intronic
1124037234 15:26065839-26065861 CTGAGCAAAGAGAAGCAGAGAGG - Intergenic
1124108077 15:26759681-26759703 CAGATCAAAAGGAAGAGGACAGG - Intronic
1124956655 15:34364747-34364769 CAGGGCAAAGATAACAGGCCAGG - Intronic
1125320334 15:38480316-38480338 CAGATCAACGAGAAAAGGAAAGG - Intronic
1125478578 15:40064206-40064228 CAACCCAATGAGAAGAGGACTGG - Intergenic
1125923527 15:43541744-43541766 GAGAGAAAAGAGAAAAGAACAGG + Intronic
1126416514 15:48423405-48423427 CAGTGGAAAGAGCACAGGACAGG - Intronic
1126909669 15:53404377-53404399 CAGAGTACAGAGAAGAAGACTGG - Intergenic
1128247218 15:66141394-66141416 GTGAGAAAAGAGAAGACGACTGG + Intronic
1128495344 15:68195199-68195221 CAGGGCAGTGAGATGAGGACAGG - Intronic
1129244617 15:74271830-74271852 CAGAGCAGAGGGCAGAGGAGGGG + Intronic
1129294464 15:74592303-74592325 CAGAACAATGTGAAGAGGAAGGG - Intronic
1129385555 15:75194251-75194273 CAGAGCAGAGAGATGTGGCCAGG + Intergenic
1129589700 15:76904787-76904809 CAGAGCTAAGATCAGAGTACAGG + Intronic
1130943043 15:88527122-88527144 AAGAACAAAGAGAATAGGAGAGG - Intronic
1130952770 15:88605427-88605449 CAAAGCAAAGAGGAGAGGCTTGG - Intergenic
1131184982 15:90266182-90266204 GCGATCAAAGAGAAGAGGGCTGG + Intronic
1131542472 15:93286733-93286755 TAGAGCAAAGAAAATAGGATCGG + Intergenic
1131616540 15:94022285-94022307 AAGAGCAGTGAGAGGAGGACGGG + Intergenic
1132267883 15:100492973-100492995 AAGAGCACAAAGAAGGGGACGGG - Intronic
1132304789 15:100803293-100803315 CAAACCCAAGAGAACAGGACAGG + Intergenic
1132931551 16:2461433-2461455 CACAGAGAAGAGAGGAGGACAGG - Intronic
1133169648 16:3973787-3973809 CAAAGCACACAGAAAAGGACCGG - Intronic
1133416338 16:5610010-5610032 CAAAGCAAAGAAAAGAAGAAGGG - Intergenic
1133880761 16:9779515-9779537 GAAAGGAAAGAAAAGAGGACAGG + Intronic
1134722040 16:16390793-16390815 GTGAGCACAGAGAAGAGGAGAGG + Exonic
1134945387 16:18321076-18321098 GTGAGCACAGAGAAGAGGAGAGG - Exonic
1135721528 16:24822255-24822277 CAGAGGAAACAGCAGAGGAGTGG + Intronic
1136611854 16:31371304-31371326 CAGAGCACCGAGCTGAGGACAGG - Intronic
1137345198 16:47651229-47651251 TAGAGCACAGAAAAGAGTACTGG - Intronic
1138124099 16:54424567-54424589 CACAGCTGAGAGCAGAGGACAGG - Intergenic
1138856214 16:60696708-60696730 CAGAGGAAGAAGAAGATGACTGG - Intergenic
1139295950 16:65900822-65900844 CAGAGGAAAGAGTTGAGGAATGG + Intergenic
1139506970 16:67403502-67403524 CCGTGGAAACAGAAGAGGACAGG + Intronic
1140631293 16:76855523-76855545 CAGAGGAAAGATATGAGGAGTGG + Intergenic
1140903571 16:79392109-79392131 GAGAGGAAAGAGAAGAAGAGAGG + Intergenic
1141031061 16:80589001-80589023 AAGAGGAAGGAGAAGAAGACTGG + Intergenic
1141417909 16:83891050-83891072 CTGAGTAAAGAGAAGCGGAATGG - Intergenic
1141774070 16:86110630-86110652 CTCAGCCAAGAGGAGAGGACAGG - Intergenic
1141865369 16:86746520-86746542 CAGAGAAAAGAGAAGAGACACGG + Intergenic
1142108388 16:88318360-88318382 CAGAGCATGGAGAGGAGGAAGGG - Intergenic
1142122942 16:88396278-88396300 CAGAGCCAGGAGATGAAGACAGG - Intergenic
1142236951 16:88926916-88926938 CAGAGAAAGGAGATGAGGGCAGG - Intronic
1143326697 17:6103687-6103709 CAGCGCACGGAGAAGGGGACTGG + Intronic
1143382296 17:6503973-6503995 CAGAGCTAAGGGGAGAGGCCTGG - Intronic
1143754596 17:9057154-9057176 GGGGGCAAAAAGAAGAGGACAGG - Intronic
1144658993 17:17056315-17056337 CATGGCAAAGGGAAGAGGGCTGG - Intronic
1145691859 17:26750488-26750510 AAGAGCAAAAACAAAAGGACAGG + Intergenic
1145912656 17:28551717-28551739 CAGAGCCCCCAGAAGAGGACAGG + Intronic
1146982494 17:37177809-37177831 AATAGCAAAGTCAAGAGGACTGG - Intronic
1147051987 17:37802170-37802192 CAGAGCAAGGAGAGGGGGAGAGG - Intergenic
1147575453 17:41596350-41596372 CAGAGAACAGAGAAGAGTCCAGG + Intergenic
1147668446 17:42163388-42163410 CAGAGCAGACAGAGGGGGACTGG + Intronic
1148153911 17:45411945-45411967 GAGAGGGGAGAGAAGAGGACAGG + Intronic
1148594194 17:48839642-48839664 CAAAGCAAAGAAAAAAGGCCGGG - Intronic
1148693884 17:49547873-49547895 CAGAGAAAACAGAAAAGGACAGG + Intergenic
1149004007 17:51785746-51785768 CTGAGCAAAAAGAAGAAAACTGG - Intronic
1149540521 17:57464737-57464759 CAGAGAAAAGAGGAAGGGACAGG - Intronic
1150009984 17:61494432-61494454 GAGTGGAAAGAGAAGAGGCCTGG + Intergenic
1150475826 17:65473961-65473983 GAGAGAGAAGAGAAGAGGAAGGG - Intergenic
1150535687 17:66037380-66037402 CAGAGGAGAGAGGAGAGAACAGG - Intronic
1150562853 17:66309809-66309831 CAGAGAAAGGAGAAGAAGACAGG + Intronic
1150851077 17:68704172-68704194 CAGAGGAAAGTGATGAGGATGGG + Intergenic
1151161799 17:72172211-72172233 CAGAGCAAAGAAAAGGAAACTGG - Intergenic
1151503370 17:74507457-74507479 CAGAGCAAAAAGAACAAAACTGG - Intergenic
1151743006 17:75996762-75996784 AAGAGAAAAGAGAAGAGAAAGGG + Intronic
1152261128 17:79267873-79267895 CAAGGCAGAGAGAAAAGGACGGG + Intronic
1152274255 17:79345633-79345655 AAGAGAAAAAAGCAGAGGACAGG - Intronic
1152592132 17:81218880-81218902 CAGGGCAGAGAGAAGGGGTCTGG - Intronic
1152699349 17:81811359-81811381 CAGAGGACAGGGAGGAGGACGGG + Intronic
1153525486 18:5991092-5991114 CCAAGCAAAGAGAAGAGGGGTGG - Intronic
1153676963 18:7464405-7464427 CAGAGCAATAAGCAGAAGACAGG + Intergenic
1153683196 18:7520612-7520634 CAGAGAGCAGAGATGAGGACAGG + Intergenic
1153776118 18:8455751-8455773 AAGGACAAAGAGAAGAGGGCAGG - Intergenic
1153861736 18:9217664-9217686 CAGAGAAAAGAGTAGACCACTGG - Intronic
1154033245 18:10772507-10772529 CAGAACACAGAGGAGAGGACTGG - Intronic
1154054552 18:11000506-11000528 CAGGGACAAGGGAAGAGGACAGG + Intronic
1154389518 18:13924364-13924386 CAGGGCAAAGACAAGATGCCAGG - Intergenic
1154531721 18:15352707-15352729 TGGAGCACAGAGAAGAGGGCAGG + Intergenic
1154943714 18:21139164-21139186 CATAGAAAATAGTAGAGGACAGG - Intergenic
1155469645 18:26177671-26177693 AAGAACAAAGAAAAGAGGAAAGG + Intronic
1155728134 18:29115747-29115769 GAGAGAAAAGAGAAGAGGTGAGG - Intergenic
1155858719 18:30868814-30868836 CATAACAAAGAGGAGAGGCCGGG + Intergenic
1156148819 18:34220267-34220289 AAGAGAAAAGGGGAGAGGACAGG - Intronic
1156270370 18:35525039-35525061 CAGGCCAAGGAGAAGAGGAGAGG - Intergenic
1157439195 18:47697130-47697152 CAGGGCACAGAGAAGAGGGTGGG - Intergenic
1158137371 18:54222934-54222956 CAGAGCTACTTGAAGAGGACAGG + Intronic
1158429239 18:57369353-57369375 CAGAGGAAGGAGAACTGGACAGG - Intronic
1159624689 18:70679034-70679056 AAGGGGAAAGAGAAGAGGAAGGG - Intergenic
1159705973 18:71688192-71688214 CACAGCAAAGAGAAGGGGAAAGG + Intergenic
1159771718 18:72553740-72553762 TGGAGCAATGAAAAGAGGACAGG + Intronic
1159855027 18:73576244-73576266 CAGAGCAAACAGAACAAGGCTGG - Intergenic
1160105606 18:75972085-75972107 AAGATTTAAGAGAAGAGGACAGG + Intergenic
1161064169 19:2229377-2229399 CCGGGCAAGGAGAGGAGGACTGG + Intronic
1163110346 19:15156819-15156841 CAGAGCACAGAGAAGAGTTGAGG + Intergenic
1163177128 19:15572206-15572228 CAAAGCTAAGAGATGAAGACTGG - Intergenic
1163179966 19:15592348-15592370 CAGGGAAAAGAGGAGAGTACAGG - Intergenic
1163369020 19:16891756-16891778 CAAAAAAAAGAGAAGAGGAGAGG + Exonic
1163900589 19:20096263-20096285 TGGAGCAAAGAACAGAGGACAGG + Intronic
1164302431 19:23973561-23973583 AAGAGTAAAAAGAAGAGGAGAGG + Intergenic
1164668908 19:30062176-30062198 CGGGGCAAAGGGAAGAAGACAGG + Intergenic
1165258525 19:34594522-34594544 CAGAGCCAGCAGAAGAGCACAGG + Exonic
1165406953 19:35636872-35636894 CAGAGCTAAGACAAGAGCTCAGG - Intronic
1165492805 19:36134900-36134922 CAGGGCGAAGAGATGAGGGCAGG + Intergenic
1165807642 19:38591027-38591049 CATAAGAAAGAGAAGAGGCCGGG + Intronic
1165912624 19:39238308-39238330 CAGAGTATAAAGAAAAGGACAGG + Intergenic
1166226622 19:41399732-41399754 GAGAGAAAAGAGAAGAGAAAAGG - Intronic
1166601719 19:44101563-44101585 CAGAGCAAGAAGGAGAGGACAGG - Intronic
1167212015 19:48139384-48139406 TAGAGAAGAGAGAAGAGGGCAGG - Intronic
1167482967 19:49744520-49744542 CAGAGCAGAGAGGGGAGGGCAGG - Intronic
1167827591 19:51987793-51987815 AAGAGAAAAGAGGAGAGGAGAGG + Intergenic
1168050581 19:53826713-53826735 CAGACCAAACAGAGGAGGCCTGG + Intergenic
1168137776 19:54362958-54362980 CAGACCAAAGAGAGGTGCACAGG + Intronic
1168174734 19:54617156-54617178 AAGAGAAAAGAGGAGAGGAGAGG + Intronic
1168409140 19:56127693-56127715 CAGAGCCAAAATAAGAGGTCTGG + Intergenic
1168588248 19:57611967-57611989 CAGAGCAAACAGCTGAGTACTGG - Intronic
1168612168 19:57810112-57810134 AAAAGAAAAGAGAAGAGGAGAGG + Intronic
926434422 2:12823945-12823967 CAGAGCAAAGACCCCAGGACTGG - Intergenic
926631241 2:15138146-15138168 CAGAGCTGAGAGCAGAGGATGGG + Intergenic
926665836 2:15521990-15522012 CAGAGCAAAGAAAACATGAGAGG + Intronic
926940397 2:18129973-18129995 CAGGGCAAAGGGAAGAGCATGGG - Intronic
927280771 2:21304438-21304460 GAAAGCACAGAGAAGAGAACTGG + Intergenic
927374755 2:22400931-22400953 CAGAGCAGAGAGAAGTAGGCAGG + Intergenic
927817310 2:26230216-26230238 CAGGGCAAAGAAAATGGGACTGG - Exonic
927899558 2:26809439-26809461 CTGAGCAAGGTGAAGAGGAGGGG + Intergenic
928937621 2:36695882-36695904 CAGGGCCAACAGATGAGGACAGG + Intergenic
929193654 2:39163489-39163511 CAGAGCAGAGAGTAGAATACTGG + Intergenic
929348749 2:40921157-40921179 CAGAGAAAAGATAGGAGCACAGG - Intergenic
929973174 2:46603409-46603431 CTGAGCAAAAAGAACAGAACTGG + Intronic
929980225 2:46671502-46671524 CAGAGGAAAGAGGATAGGATGGG - Intergenic
930148006 2:48027110-48027132 CAGCGGGAAGAGCAGAGGACTGG - Intergenic
930253746 2:49065371-49065393 AACAGGAATGAGAAGAGGACTGG + Intronic
930590572 2:53321973-53321995 CAGAGTAAAGAGAAGAAGTGTGG - Intergenic
930997443 2:57737503-57737525 CAGAGCAGAAAGAAGGAGACTGG + Intergenic
931629134 2:64283738-64283760 AACAGCATAGAGAAGAGGTCTGG + Intergenic
931927204 2:67086407-67086429 CAGAGCAGAGAGAGAAGGAGAGG - Intergenic
932163110 2:69480971-69480993 CAGAGCATTAAGAAGAGGAAAGG + Intronic
932439174 2:71721025-71721047 CAGAGAGAGGAGAAGAGGAGTGG - Intergenic
932517893 2:72372368-72372390 CTGAGCAAAAAGAACAGAACTGG + Intronic
933729962 2:85449023-85449045 CAAAGCAAAGAGAAGATAATAGG - Intergenic
934906907 2:98213192-98213214 CAGAGAAAAAAGCTGAGGACAGG + Intronic
936660559 2:114538260-114538282 CAGAGAAGAAAGAAGAGGAAAGG + Intronic
936922238 2:117700825-117700847 GAGAGAAATGAGAAGAGGAGAGG + Intergenic
937021511 2:118661117-118661139 CAAAACAAAGAGAAAAGGAAAGG - Intergenic
937227251 2:120377064-120377086 CAGAGAGAACAGAAGAGGAAAGG - Intergenic
937248936 2:120511341-120511363 GAGAGAAAAGGGAAGAGGAGGGG - Intergenic
937885041 2:126893887-126893909 CAAACCAAAGAGAGGAGAACTGG + Intergenic
938530817 2:132183952-132183974 TGGAGCACAGAGAAGAGGGCAGG + Intronic
938711461 2:133979230-133979252 CTGAGCAAATAGCACAGGACTGG + Intergenic
938719818 2:134056669-134056691 CAGAGGAAGGAGAAAAAGACAGG + Intergenic
939264983 2:139860921-139860943 CAGAACAAAGAAAAGAGTAATGG + Intergenic
939772762 2:146343448-146343470 CAGTGCCAAGAGAAGTGTACTGG + Intergenic
940268002 2:151860413-151860435 CTGAGCAAAGTGGAGATGACTGG + Intronic
940898917 2:159108486-159108508 CAGAGAAAATAGATGAGGGCAGG + Intronic
941354041 2:164467079-164467101 CATAGCAAAGAGAAAAAGTCAGG + Intergenic
941581853 2:167307320-167307342 CTGAGCAAAGAGAATAAGATAGG - Intergenic
941919769 2:170838755-170838777 CTGAGCTAAGAGAAGAGTAAGGG - Intronic
942381172 2:175392669-175392691 CAGAGGAAAGTGAACAGGAATGG - Intergenic
942761631 2:179405347-179405369 CAGAGCAAAGAGAGTAAGAGAGG - Intergenic
943236632 2:185329548-185329570 CTGAGCAAAAAGAAGAAAACTGG - Intergenic
943636030 2:190307932-190307954 CAGAGTTATGAGAAGTGGACAGG - Intronic
943809312 2:192164293-192164315 CGGAGCAAAGGGAAGAGCACAGG - Intronic
945283071 2:208055505-208055527 CAAAGCAAAGCTAAGAGAACAGG + Intergenic
945388863 2:209239245-209239267 CAAAGCAATGAGGAGAGGATAGG + Intergenic
945986587 2:216359353-216359375 CAGAGAAAAGAGAAAAGAAGAGG - Intronic
946854724 2:223941410-223941432 CAGAGGAAGGAGGAAAGGACAGG - Intronic
947013202 2:225589050-225589072 GAGTGAAAAGAGAAGAGGAGAGG - Intronic
947690084 2:232127303-232127325 CACAGGAAAGACAAGAGGAAGGG - Intronic
947858118 2:233338258-233338280 CAGAGCTCAGAGAAGGGGCCTGG + Intronic
948261028 2:236604644-236604666 CAGAGCACAGCAAAGAGGGCAGG - Intergenic
948274439 2:236697284-236697306 GAGAGCAAACTGAAGAGGAGAGG + Intergenic
948360965 2:237419975-237419997 CAAAGCAGAGAGAAGTGGAGAGG + Intergenic
948663561 2:239521093-239521115 CTGAGAAAAGAAAAGAGGGCAGG - Intergenic
948674369 2:239588417-239588439 CATAGCAAAGAGGAGTGTACGGG - Intergenic
948946229 2:241221373-241221395 AAGAAAAAAGAGAATAGGACGGG - Intronic
1170462785 20:16594012-16594034 AAGAAAAAAGAGAAGAGGAGAGG + Intergenic
1170780852 20:19424042-19424064 CATAGCAGAGCGAAGAGGAAAGG + Intronic
1171284540 20:23926270-23926292 CACAGCCTAGTGAAGAGGACAGG + Intergenic
1172034803 20:32003156-32003178 AAAAGGAAACAGAAGAGGACAGG - Exonic
1172122612 20:32607761-32607783 CACAGAAGAGAGAAGGGGACAGG - Intronic
1172584804 20:36075502-36075524 CAGAGCAAAGAGCAAATGATAGG - Intergenic
1172599420 20:36173626-36173648 CAGGGCAAAGGGAGGAGGAAGGG - Intronic
1172640536 20:36437729-36437751 CAGAGGGAAGAGAACAGGTCAGG + Intronic
1173114719 20:40230295-40230317 GAGAGCAAAGAGAAAGGGGCAGG + Intergenic
1173235507 20:41241687-41241709 CAGAGCAAAAAGAACAAAACTGG - Intronic
1173498955 20:43538737-43538759 CAGAGCACAGGGAAGAGCACAGG - Intronic
1173600633 20:44292517-44292539 GAGAGAAAAGAGGAGAGGAGAGG + Intergenic
1173908881 20:46649461-46649483 CAGAGCAGAGAGAAGCTGTCGGG + Intronic
1173947029 20:46959780-46959802 CAGAGAAAAGAGATGAGCCCTGG - Intronic
1174592041 20:51653768-51653790 CAGAGCAAAAAAAAAAGGCCTGG + Intronic
1174943111 20:54954324-54954346 CAGATCAAAGGTAGGAGGACAGG - Intergenic
1175266235 20:57705062-57705084 CAACCCAAAGAGAAGAGGGCAGG + Intronic
1175467826 20:59204512-59204534 CAAAGCAAAGAGAAGAGCAGTGG - Intronic
1175669504 20:60889967-60889989 CAGAGCAAACAGAAGTGCAAAGG + Intergenic
1176757040 21:10733270-10733292 CAGAGCAGAGAGGAGTGGAGTGG - Intergenic
1176765637 21:13015461-13015483 TGGAGCACAGAGAAGAGGGCAGG - Intergenic
1176891654 21:14326798-14326820 GAGAGAAGAGAGAAGAGGAGGGG + Intergenic
1176968155 21:15235143-15235165 CAGGCAAAAGAGAAGAGGGCAGG - Intergenic
1177748506 21:25251241-25251263 CAGAGGAAAGAGAAAGAGACAGG - Intergenic
1177766719 21:25466727-25466749 CATATTTAAGAGAAGAGGACTGG - Intergenic
1177807015 21:25884439-25884461 CACAGCAAAGGAAAGAGGAGAGG - Intronic
1178199357 21:30386497-30386519 GAGAGGAAAGAGGAGAGGAAGGG + Intronic
1178416631 21:32410534-32410556 CAGAGCAAAGGGAAGAGCCAGGG - Intergenic
1178642074 21:34352765-34352787 CAGAGCAAAAGGAAGAGAGCTGG - Intergenic
1179138209 21:38699186-38699208 CAGAACAAAGAGAGGAGCACTGG + Intergenic
1179649456 21:42797713-42797735 CAGAGCAAAAGCAGGAGGACTGG - Intergenic
1180059989 21:45379815-45379837 CAGAGGAAATGGAAGAGGAAGGG - Intergenic
1180430218 22:15241979-15242001 TGGAGCACAGAGAAGAGGGCAGG - Intergenic
1180512826 22:16110214-16110236 TGGAGCACAGAGAAGAGGGCAGG - Intergenic
1180709573 22:17830745-17830767 CAGAGGGAAGAGTAGAGAACTGG + Intronic
1181014880 22:20063170-20063192 AAGAGAAAAGAGAAGAGAAGAGG + Intronic
1181642181 22:24208066-24208088 CAGAGAACAGAAAAGAGGAAAGG - Intergenic
1181807885 22:25386047-25386069 CTGAGCACACAGAACAGGACAGG + Intronic
1182033015 22:27174902-27174924 CAGAGCAGGGAGAAGAGGGATGG + Intergenic
1182164702 22:28161709-28161731 AAGAGGAAAGGAAAGAGGACAGG + Intronic
1182217332 22:28730227-28730249 AAGAGGAAAGAAAAGAGGAGAGG + Intronic
1182309737 22:29396074-29396096 AAGAGAAAAGAGAAGAGAAGAGG + Intronic
1183160593 22:36110514-36110536 CAGAGAAAAGAGATTTGGACAGG + Intergenic
1183186496 22:36294455-36294477 CAGCTAAGAGAGAAGAGGACAGG - Intronic
1183285907 22:36963519-36963541 GAGAGGAAAGGGAAGAGGAAGGG - Intergenic
1184291891 22:43501785-43501807 CAGAGAAAAGAGACCAGGAATGG - Intronic
1184441209 22:44517358-44517380 AAGGACAAAGAGAACAGGACAGG - Intergenic
1184897647 22:47420967-47420989 CAGAGGAAAGACAAAAGGAGAGG - Intergenic
1185105968 22:48870055-48870077 CAGGGCAGAGAGAAGGGGAATGG - Intergenic
1185157891 22:49205229-49205251 CAGAGCAGAGAAAGGAGGAGAGG + Intergenic
1185178005 22:49341277-49341299 CTCAGGGAAGAGAAGAGGACAGG - Intergenic
949166311 3:945700-945722 CAGAGCAAAGACAAGAATGCTGG + Intergenic
949561082 3:5203201-5203223 CAGAGCCCAGAGAAGATGAAAGG - Intronic
950140599 3:10612481-10612503 CAAAGCAAATAGAGGAGGAGGGG - Intronic
950270590 3:11611545-11611567 GAGAGGAAAGAAGAGAGGACGGG + Intronic
950420418 3:12895533-12895555 CAGGGAACAGAGGAGAGGACCGG + Intergenic
950848343 3:16036593-16036615 GAGAGCCAAGAGAATATGACCGG + Intergenic
950934512 3:16824883-16824905 CAGAGGTGAGAGAAGAGGGCAGG + Intronic
951029295 3:17863377-17863399 AAAAGCAAAGAGAAGAGTAAAGG - Intronic
951136457 3:19108686-19108708 CAGAACAAAGATAACAAGACTGG - Intergenic
951179457 3:19641933-19641955 AAGAACAAAGAGAAGAGGTGGGG + Intergenic
951355330 3:21660138-21660160 AAGAGCAAAGAGAGGAGGTGGGG - Intronic
952845040 3:37681245-37681267 CAGAGCATAGACAAGAAGGCTGG + Intronic
953100760 3:39824293-39824315 CAGAGCAAAGAGAACAATGCTGG - Intronic
953293574 3:41690580-41690602 GAGAGCTAAGAAAAGAGGAAAGG - Intronic
953604530 3:44402840-44402862 CAAGGAGAAGAGAAGAGGACAGG + Intronic
954009025 3:47618636-47618658 CAGGGCTGAGAGAAGAGGAGCGG + Intronic
955057975 3:55473256-55473278 CAGAGTAAACTGTAGAGGACTGG - Intronic
955150081 3:56358269-56358291 AAGAGGAAAGAGAGGAGGATGGG - Intronic
955393289 3:58536597-58536619 CAGAGCAAGGAAAAGAGGTAAGG - Intronic
955393330 3:58536806-58536828 GAGAGCAGAGTGAGGAGGACAGG - Intronic
955506463 3:59638055-59638077 AAGAGCAAAGAGAGGATGAGAGG + Intergenic
956163389 3:66377994-66378016 GAGAGCTAAGAGAAGAAAACGGG + Exonic
956506112 3:69942086-69942108 CAGAGGAAACAGAAAAGGATTGG - Intronic
958871295 3:99562190-99562212 AAGAGGAAAGAGAAGAGGAAAGG - Intergenic
959567685 3:107849280-107849302 GAGGCCAAAGAGCAGAGGACAGG + Intergenic
960314570 3:116160465-116160487 AAGAGAAAAGAGGAGAGGAGAGG + Intronic
960965862 3:123104307-123104329 CAGGGCAGAGGGAAGGGGACAGG + Intronic
961861652 3:129921202-129921224 CAGAACAAGGAGAAGACGGCTGG + Intergenic
962714984 3:138118126-138118148 AAGAGCAAAGAGAAGAGTCCAGG + Intergenic
962724250 3:138206685-138206707 GAAAGAAGAGAGAAGAGGACTGG + Intronic
962878301 3:139552933-139552955 CAGAGCACAGGGAAGTGGCCAGG - Intergenic
963025714 3:140916858-140916880 GAGAGGAAAGAGAAGAGAAGAGG - Intergenic
964375226 3:156042619-156042641 CAAAACAAACAGAAGAGGATGGG - Intronic
964499017 3:157327614-157327636 CACAGCAAAGGGTAGAGGATGGG + Intronic
965590015 3:170354017-170354039 AAGTGTAAAGGGAAGAGGACAGG + Intergenic
966388564 3:179427852-179427874 AAGAGAAAAGAGACCAGGACAGG - Intronic
966854129 3:184182630-184182652 CAGAACAAGGAGAAGTGGTCAGG - Intronic
967278327 3:187798260-187798282 CAGAGTCAAGAGAGGAAGACAGG + Intergenic
967526413 3:190499333-190499355 CACAGAAAACAGAAGAGGAAGGG - Intergenic
967553353 3:190825785-190825807 AAGAGGAAAGAGGAGAGGAAAGG - Intergenic
967727721 3:192877485-192877507 CAGAGCTCAGGGTAGAGGACTGG - Intronic
967731924 3:192915148-192915170 CAGAACAAAGCCAAGAGGACTGG + Intronic
967774126 3:193368705-193368727 CAGAGCAAAACGAATAGCACTGG + Intronic
969302235 4:6303904-6303926 CACAGCAAAGAGGTGAGGCCTGG - Intergenic
970213146 4:13731663-13731685 CAGAGATAAGAGAAGAGGCAGGG + Intergenic
970676936 4:18461926-18461948 CAGAGCAGAGAGAAGAAAAATGG + Intergenic
971146431 4:23981555-23981577 CTGACCAAAGAGAAGGGGCCAGG + Intergenic
971364258 4:25964907-25964929 CACAGAAAATAGAAGAGGCCTGG + Intergenic
971451235 4:26803901-26803923 TGCAGCAAAGAGAAGGGGACGGG + Intergenic
971469673 4:27008872-27008894 CAGAATAAAGGGAAGAGGTCAGG - Exonic
972134305 4:35872810-35872832 GAGGGCAAAGGGAAGAGAACAGG + Intergenic
972204101 4:36749887-36749909 AAGAACAAAGAGAAAAGAACAGG + Intergenic
973291524 4:48475965-48475987 CAGAGCAAACAGGATAGGCCAGG + Intergenic
973963858 4:56140265-56140287 CAGAGCAAAGACTAGAGAACAGG - Intergenic
974106845 4:57479418-57479440 CAGAGCCTAGAGAAAATGACAGG + Intergenic
974367162 4:60965050-60965072 CAAAGCAAAGAAAAGAAGAAAGG + Intergenic
974428546 4:61768773-61768795 CAGAGAAAAGAGTAGAGGCACGG + Intronic
974511400 4:62846646-62846668 CAAAGCAAAGAGAGGAAGAAAGG + Intergenic
974972906 4:68852565-68852587 CAAAGAAAACAGAATAGGACAGG + Intergenic
975839068 4:78455095-78455117 CAGAGCAAAGAGAAGAGGACTGG - Intronic
976267185 4:83195446-83195468 AAGAGCAAGGAGAAGAGGGCGGG - Intergenic
976318552 4:83685651-83685673 CTGGGCAAAGGGAATAGGACAGG - Intergenic
976594006 4:86877344-86877366 AAGAACAAATAGGAGAGGACAGG + Intronic
976803417 4:89019017-89019039 CAGAGAAGTGAGAAGAGGCCAGG + Intronic
976908571 4:90271188-90271210 CTGAACAAAAAGAAGAAGACTGG + Intronic
976909612 4:90285089-90285111 CTGAGCAAAGAGAACAAAACTGG - Intronic
977109104 4:92928265-92928287 CAGAGTAAAAAGTAGAGGGCTGG + Intronic
977708377 4:100096733-100096755 CAGAGCAAAAAGGAGAGCTCTGG - Intergenic
978169339 4:105650493-105650515 CAGAGTAAAGAGTTTAGGACTGG - Intronic
978545226 4:109864354-109864376 ACCAGCAAAGAGAAGAGCACAGG - Intronic
978653777 4:111041565-111041587 GAGAGCAAAGAGATGAAAACTGG - Intergenic
978784320 4:112592582-112592604 GAGAGCATAGAGAAGAGAATGGG - Intronic
978860755 4:113446035-113446057 AAGAGCAAATAGGAGAGGAAGGG + Intergenic
978999867 4:115203143-115203165 GAGGGCAAAGAGAAGAGGGAAGG - Intergenic
979010308 4:115358460-115358482 CAGAGCAAAGAGAGGGCCACAGG - Intergenic
979532965 4:121788547-121788569 GAGAGCCCAGAGAAGAGGTCTGG + Intergenic
979708601 4:123750599-123750621 GAGAGCAATGAGATGAGGAGAGG - Intergenic
980556944 4:134419935-134419957 AAGAGCAAAGAGAAAAGCATAGG - Intergenic
981313559 4:143319650-143319672 TAGAGCAAAGGAAAGAGGAAGGG + Intergenic
983028767 4:162771921-162771943 CAGAACAAAGAGAAGAGGAGAGG + Intergenic
983057998 4:163122340-163122362 CAGAACAAAAAGAAGTGGAGAGG + Intronic
983077351 4:163343212-163343234 AATAGCAAAGAGAAGACGAAGGG - Intronic
983256450 4:165405716-165405738 CAGGGCAAAGAAAATGGGACTGG - Intronic
983489975 4:168377355-168377377 CAGAAAGAATAGAAGAGGACTGG - Intronic
984724745 4:183009876-183009898 CTGGGCAAAGGGAAGAGGAGAGG - Intergenic
984853196 4:184171339-184171361 GAGAGCAAAGAGAACAGGCTTGG + Intronic
984966532 4:185144702-185144724 TAGAGAGAAGGGAAGAGGACAGG - Intronic
985680878 5:1254973-1254995 CAGGGCAAACAGGAGAGGCCAGG + Intronic
985916726 5:2925797-2925819 CAGAGGAAGAAGAAGAGGAAAGG - Intergenic
986241686 5:5965566-5965588 GAGAGGAAAGAGGGGAGGACAGG - Intergenic
986351387 5:6883095-6883117 AAGTGCAGAGAGAAGAGCACAGG - Intergenic
986446948 5:7829747-7829769 CAGAGCAAAGGAAAGATGAATGG - Exonic
986725075 5:10589270-10589292 AAGACCAAAGAGAAGAGGGGAGG - Intronic
987010105 5:13754499-13754521 CAGGGCAAAGGAGAGAGGACTGG - Intronic
987537992 5:19213180-19213202 CAGAGCAAAAAGAACAAAACTGG + Intergenic
989412781 5:41139820-41139842 TGGAGCACAGAGAAGAGGAAAGG - Intergenic
989498430 5:42137177-42137199 CAGAGCAAAAAGAACAAAACTGG + Intergenic
990113131 5:52352705-52352727 CAGAGCAATTTGAAGAGGCCTGG + Intergenic
990797457 5:59560613-59560635 CAGAGGAGAGAGCAGAGCACTGG + Intronic
991018382 5:61955678-61955700 CTGAGCAAAAAGAACAGAACTGG - Intergenic
991434565 5:66584419-66584441 CAAAGCAAAGAAAATAGGAGTGG + Intergenic
992102833 5:73423705-73423727 CAGAACAAAGAGAACAGGACAGG + Intergenic
992218690 5:74550185-74550207 CAGAGGAAAGAAAACAGGAAGGG + Intergenic
992813989 5:80418252-80418274 AAGAGCAAAGAGGAGGGGAAAGG - Intronic
993361711 5:86984964-86984986 CAGAGAGCAGAGAAGAGGAAAGG + Intergenic
993456555 5:88133657-88133679 GAGAGAAAAGAGAAGAGGAGAGG + Intergenic
993499756 5:88651989-88652011 CTGAGCAAAGGGAAGGGGTCAGG - Intergenic
994248348 5:97507162-97507184 CTGAGCAAAAAGAACAGAACTGG - Intergenic
995152396 5:108864425-108864447 CAGAGCAAAGAGCAGAGAAAAGG - Intronic
995428378 5:112048993-112049015 CAGAGGAGAGAGGAGAGGAGGGG + Intergenic
995714495 5:115068784-115068806 CAGAAAAAGGAGAAGAGGAGGGG - Intergenic
996052206 5:118947547-118947569 CAGAGAGAAGAGAAGGGGAGAGG - Intronic
996383121 5:122882534-122882556 CAGAACAAAGAGATGAGGGCAGG - Intronic
998872078 5:146562298-146562320 CAGAGCATAGAAAAGATGAGAGG - Intergenic
999310705 5:150549996-150550018 CAGACCAAAGAGAAGACCCCAGG - Intronic
999390517 5:151186348-151186370 AAGAGGAAAGAAAAGAAGACGGG + Intronic
999928598 5:156406434-156406456 CAAAATAAAGAGAAGAGGAGAGG - Intronic
1000261041 5:159588947-159588969 CTGACCACAGAGGAGAGGACAGG + Intergenic
1000332556 5:160217387-160217409 CAGAGAAAAGACAAGAAGAAGGG + Intronic
1000438389 5:161240986-161241008 GGGTGCAGAGAGAAGAGGACGGG - Intergenic
1001677095 5:173528094-173528116 CAGGACGAAGAGAAGAGGAGAGG - Intergenic
1002072975 5:176691455-176691477 GAAAGCAAAGAGAAGAGGGTTGG - Intergenic
1002516082 5:179760032-179760054 CAGAGGAAAGGAAACAGGACTGG + Intronic
1002963423 6:1938994-1939016 GAGAGAGAAGAGAAGAGGAGAGG - Intronic
1003221610 6:4165430-4165452 CAGAACAAATAGAAGAGAACTGG - Intergenic
1003399573 6:5780912-5780934 CCTAGCAAAGAGTGGAGGACAGG - Intergenic
1003517253 6:6827406-6827428 CAGAGGAGAGAGAAGAGAAAGGG + Intergenic
1004281587 6:14284239-14284261 AAGAGGAAAGAGAGGAGGAAAGG + Intergenic
1004618096 6:17309572-17309594 CAGAGAGAAGAGAAGAGAACTGG - Intergenic
1004902726 6:20209009-20209031 CAAAACAAAGTGAGGAGGACAGG + Intronic
1004986914 6:21092653-21092675 CAAAGCAAACAGAATAGGAATGG + Intronic
1005091241 6:22059109-22059131 CAGAGAAAAGGGAAGAAAACAGG - Intergenic
1005496858 6:26395358-26395380 CAGAGAAAATAGATGAGGAGGGG - Intergenic
1005506176 6:26470641-26470663 CAGAGCAAAAGGCAGAGGAAAGG + Intronic
1005802410 6:29440493-29440515 AAGGGCAAAGAGAAGATGAAAGG - Exonic
1006113090 6:31760591-31760613 CACATCAAAGAGAAATGGACAGG - Intronic
1006151796 6:31993843-31993865 CACAGCACAGAGAAAAGGCCGGG - Intronic
1006158097 6:32026581-32026603 CACAGCACAGAGAAAAGGCCGGG - Intronic
1006303829 6:33207623-33207645 GGGAGGAAAGAGAAGAGGAAGGG - Intergenic
1006442562 6:34061343-34061365 CAGAGTACAGAGAAGAGCTCTGG - Intronic
1006478528 6:34273484-34273506 CTGAGCTGAGATAAGAGGACCGG + Intergenic
1006553481 6:34845292-34845314 CTGAGCAAAGAGAAGAAAACTGG - Intronic
1006579248 6:35067193-35067215 GAAAGCAAAGAGGAGGGGACAGG - Intronic
1006780518 6:36629318-36629340 GAGACCAAAGAGAAGGGCACAGG + Intergenic
1007341740 6:41194935-41194957 CAAGGAGAAGAGAAGAGGACAGG - Intronic
1007930824 6:45689049-45689071 CAGAAGAAAGACAGGAGGACTGG + Intergenic
1008192734 6:48480312-48480334 CTGAGCAAAAAGAACAAGACTGG + Intergenic
1008489724 6:52073872-52073894 CAGAGCCAAGAGAATGGAACAGG - Intronic
1008788645 6:55201330-55201352 CAGAGAAAAGAGAACAGCAAAGG - Intronic
1008964253 6:57298459-57298481 GAGAACAAAGAGATGAGGAGTGG + Intergenic
1009484476 6:64202752-64202774 AAGAGGAAAGAGAAGGGGAAAGG + Intronic
1010613925 6:77990512-77990534 GGGAGCAGAGAGGAGAGGACAGG - Intergenic
1011024370 6:82850861-82850883 CAGAGCAAAAAGAACATAACTGG + Intergenic
1011091919 6:83612578-83612600 TAAAGAAAAGAGAAGAGGCCAGG + Intronic
1011111252 6:83838844-83838866 AAGGACAAAGAGAAGAGGAGTGG + Intergenic
1012562113 6:100595613-100595635 CACTGAAAAGAGAAGTGGACAGG + Intronic
1012569348 6:100702491-100702513 CAGAGCTCAGAAAAGAGGTCTGG + Intronic
1012920086 6:105212534-105212556 CCAAGCAAAGGGAAGAGGAAAGG - Intergenic
1013246617 6:108293627-108293649 AAAAGAAAAGAGAAGAGGAGGGG - Intergenic
1013348236 6:109282957-109282979 AAGAGAAAAGAGAAGAGGGGAGG - Intergenic
1013611734 6:111802249-111802271 CAGAGCAAGAGGAAGAGGAGAGG - Intronic
1014693687 6:124593031-124593053 AAGAGCAAAGGGAATAGGATGGG - Intronic
1014934668 6:127373827-127373849 GAAAGCAAAGGCAAGAGGACGGG - Intergenic
1014948005 6:127519013-127519035 AAGAGGAAAGAGAAGAAGGCGGG + Exonic
1015374923 6:132499703-132499725 GTGAGGAAAGAGAAGAGGCCTGG - Intronic
1015889513 6:137955486-137955508 CAGGGCAAGAAGAAGAGGGCGGG + Intergenic
1016709757 6:147156273-147156295 CACAGGAAAGGGAAGAGGAGGGG + Intergenic
1018079140 6:160243787-160243809 CTGAGCAAAGAGGAGAGTTCAGG + Intronic
1018318817 6:162584896-162584918 AAAAGAAAAGAGAAGAGGAGAGG - Intronic
1018549666 6:164981303-164981325 CAGAGCAGAGAGAAGGGGAAAGG + Intergenic
1018582732 6:165321468-165321490 CAGAGAAAAGAGAAGGCAACTGG + Intergenic
1019026267 6:168966125-168966147 CAGAGAAAAGAGGAGAGGGGAGG - Intergenic
1019564833 7:1674137-1674159 CAGAGCAGGGAGCAGAGGAGTGG - Intergenic
1019779294 7:2930105-2930127 CAGAGAAAGGAGAAGGGGGCCGG + Intronic
1019871887 7:3771345-3771367 CAGAGTCAAGAGGAGAGGAAAGG + Intronic
1020609860 7:10381932-10381954 CTGAGCAAAAAGAAGAAAACTGG + Intergenic
1020652912 7:10896508-10896530 CTGAGCAAAAAGAAGAAAACTGG + Intergenic
1021344160 7:19502947-19502969 TAGAGTGAAGAGAAGAGGAAAGG + Intergenic
1022414025 7:30162837-30162859 AAGAGCAAAGAGTAAAGGACCGG + Intergenic
1022422459 7:30236869-30236891 CAGAGCAAAAAGAAGAAACCTGG - Intergenic
1022622114 7:31995242-31995264 CAGTGAGAAGAGAAGAGGAAGGG + Intronic
1022879682 7:34573502-34573524 AAGAGATAAGAGTAGAGGACTGG - Intergenic
1023473452 7:40550959-40550981 AAGAGAAAAGAGAAGAAAACAGG - Intronic
1023631555 7:42169766-42169788 AAGAGAAAAGAGAAAAGAACAGG + Intronic
1026437094 7:70408487-70408509 CAGGGCAGAGAGAACAGGAAAGG + Intronic
1027433460 7:78138352-78138374 GAGAAGAAAGAGAAGAGGAGAGG + Intronic
1027505460 7:79012366-79012388 CAGAGCAGAGAGAAGACTTCCGG - Intronic
1027547025 7:79540414-79540436 CAGAGAAGAGAGAAGAGAAAAGG - Intergenic
1027842621 7:83332266-83332288 TAGATCAAATAGAAGAGAACTGG - Intergenic
1030205007 7:106944200-106944222 CAGAGCAAAGGGAGAAGGGCAGG - Intergenic
1030307585 7:108034744-108034766 GAGAGCAAAGAGAGGACTACAGG + Intronic
1030318424 7:108139997-108140019 CAGAGAAAATAGAAAAGAACAGG + Intergenic
1030544737 7:110878113-110878135 AAGAGCAGAAAGAACAGGACAGG - Intronic
1030944521 7:115700360-115700382 GAGAGAAGAGAGAAGAGGAGAGG - Intergenic
1031056144 7:116994868-116994890 AAGAGCGAACAGAAAAGGACTGG - Intronic
1032706025 7:134421974-134421996 CAGAGGAGAGAGAAGAGTCCTGG - Intergenic
1032853995 7:135818927-135818949 CAGAGGAAAAAGAAGAGGAGAGG - Intergenic
1033100028 7:138461470-138461492 CAGAGGAGAGGGAAGAGAACTGG - Intronic
1033529605 7:142248701-142248723 CTGAGCCAAGAGAAGAGGAGAGG + Intergenic
1034000412 7:147406182-147406204 CAGAGAAAAAAGAAAAGGAAAGG + Intronic
1034123319 7:148647074-148647096 AAGAGAAGAGAGAACAGGACTGG - Intergenic
1034525254 7:151655594-151655616 CAGAGCAAAAAGAAAATGAGAGG + Intronic
1034608630 7:152343427-152343449 AAAAGCAAAGAGAAAAAGACTGG + Intronic
1034880285 7:154757663-154757685 CAGAGGATAGATAAGAGGCCAGG - Intronic
1036445379 8:8817606-8817628 CACAGCAAGGAGAACAGGAGGGG - Intronic
1036534053 8:9628021-9628043 CAGAGCAAAAAGTAGACGAGAGG - Intronic
1037916991 8:22778788-22778810 CAGAGCAAGGAGAGAAGGCCAGG - Intronic
1038037860 8:23701999-23702021 GGGAAGAAAGAGAAGAGGACGGG - Intergenic
1038237955 8:25779506-25779528 CTGAGCAAAGAGAACAAAACTGG - Intergenic
1038615934 8:29095053-29095075 AAGAGCAGAGAGAAAAGGATGGG + Intronic
1038687791 8:29734280-29734302 TAGAGCAAAGAAGAGAGGGCGGG - Intergenic
1038995874 8:32922741-32922763 CAGGGCACAGATTAGAGGACTGG + Intergenic
1039532922 8:38280181-38280203 CAGAGCAAACAGATAAGCACTGG - Intronic
1039823470 8:41154119-41154141 CAGAGCTAAGGGAAGAGGGAGGG + Intergenic
1040483587 8:47849727-47849749 CAGAGCACAGTGATGTGGACTGG - Intronic
1041988235 8:63953105-63953127 AAGAGCAAAGAGAATAGCATAGG - Intergenic
1042150336 8:65775921-65775943 CAAAGAAAAGGGAAGAGGCCGGG - Intronic
1043222126 8:77679801-77679823 CAAAGCAAAGAGAAGAAAAATGG + Intergenic
1043280690 8:78461996-78462018 CACTGAAAAGAGGAGAGGACAGG - Intergenic
1043348009 8:79322658-79322680 GAGAGCAACTAGAAGAGGAGGGG - Intergenic
1043662926 8:82768531-82768553 CAGACCCAAGAGAAGAGGAAAGG - Intergenic
1043670154 8:82874559-82874581 TGGAGGAAGGAGAAGAGGACTGG + Intergenic
1043919589 8:85965824-85965846 CAGAGCACAGTGGAGAGGACTGG + Intergenic
1043947339 8:86269269-86269291 AACAGCAAAGAAAAGAGGAAGGG + Intronic
1044462899 8:92466929-92466951 CAGAGCACAGAAGAGAGAACAGG + Intergenic
1046467530 8:114625845-114625867 CAGAGCAAAAAGAAGAAATCTGG + Intergenic
1046698579 8:117373601-117373623 AAGAGAGTAGAGAAGAGGACAGG + Intergenic
1046780677 8:118211336-118211358 CACTGCAAAGAGGAGAGGAGAGG - Intronic
1047305228 8:123647531-123647553 AAGACCAAAGAGAAGAGAGCAGG + Intronic
1047624963 8:126647187-126647209 AAGAGAAAAGAGGAGAGGAGGGG - Intergenic
1047656838 8:126986477-126986499 CTGAGCAAAAAGAACAGAACTGG - Intergenic
1047691166 8:127356135-127356157 TAGAGAAAACAGAAGAGGAGTGG + Intergenic
1047842938 8:128773905-128773927 CAGAGAAAAGTGAAAAGAACAGG - Intergenic
1048417916 8:134247520-134247542 CTGAGCAAAAAGAACAGAACTGG + Intergenic
1048813676 8:138310921-138310943 CTAAGAAAAGAGAAGAGGACAGG + Intronic
1049750799 8:144282699-144282721 CAGAGGATAGGGATGAGGACAGG - Intronic
1049793398 8:144483896-144483918 CAGAGCAGAGAGATGAGCAGGGG - Intronic
1050387921 9:5110732-5110754 CAGAGCAAAGAAAATAACACGGG - Intronic
1050434803 9:5597763-5597785 CAGAGCAAAGAGAGAAAGAGAGG + Intergenic
1051348537 9:16175455-16175477 CAGAGCCAAGAGAAGGGTAAGGG - Intergenic
1051793560 9:20837009-20837031 GAGAGCAGAGAAAAGGGGACTGG - Intronic
1051960494 9:22755715-22755737 AAAAGGAAAGAGGAGAGGACAGG + Intergenic
1052040723 9:23735875-23735897 CAGAGCAAGGAGAGGAAAACAGG + Intronic
1053158231 9:35794654-35794676 CTGAGCAAAGAGAAAAAGATAGG + Intronic
1053278556 9:36801476-36801498 AAGAGCAAAGAGAAGATGGAAGG + Intergenic
1053522519 9:38794657-38794679 CAGAGACAGGAGGAGAGGACAGG - Intergenic
1053709422 9:40790466-40790488 TGGAGCACAGAGAAGAGGGCAGG + Intergenic
1054194747 9:62019079-62019101 CAGAGACAGGAGGAGAGGACAGG - Intergenic
1054419330 9:64911269-64911291 TGGAGCACAGAGAAGAGGGCAGG + Intergenic
1054643661 9:67569611-67569633 CAGAGACAGGAGGAGAGGACAGG + Intergenic
1055954231 9:81759222-81759244 CAGAGGAAAGAAAAGGGGAAAGG - Intergenic
1055970262 9:81904993-81905015 CATATCAAAGAGAGGAGGAAGGG + Intergenic
1055979209 9:81985312-81985334 CATATTAAAGAGAAGAGGAAGGG + Intergenic
1056210325 9:84359113-84359135 CAGAGCAAGAAGGAGAGGACGGG - Intergenic
1056795875 9:89658598-89658620 CGGAGCAATGAGGAGAGGACTGG - Intergenic
1057838801 9:98468380-98468402 AAGAGCAAGTACAAGAGGACAGG + Intronic
1058569610 9:106326495-106326517 AAGAGAAAAGAAAAGAGGGCGGG - Intergenic
1058671250 9:107362221-107362243 CAGAGGCAAGGGAAGAGAACTGG + Intergenic
1058857528 9:109078191-109078213 CATAGCACAAAGAAGAGGGCTGG - Intronic
1059649232 9:116299707-116299729 CAGAGCAAGAAGTAGAAGACTGG - Intronic
1060098788 9:120818949-120818971 CAGAGGAAGGGGAATAGGACTGG + Intronic
1060409037 9:123387871-123387893 AAGACAAAAGAGAAGAGAACAGG + Intronic
1060675898 9:125514246-125514268 GGGAGCACAGAGAAGGGGACAGG - Intronic
1060763434 9:126275303-126275325 CAGAATAAAGAGAAGAGGAGAGG - Intergenic
1060785308 9:126447998-126448020 CAGAGCAGAGGGAGGAGGAGGGG - Intronic
1060976631 9:127768782-127768804 CAGAGCAAGGTGGGGAGGACAGG - Intronic
1061262241 9:129486815-129486837 AGGAACACAGAGAAGAGGACAGG - Intergenic
1061585908 9:131568218-131568240 CAGAGCAAGGACAAAAGGCCAGG + Intergenic
1061752303 9:132788000-132788022 CAGTCCAAACAGAAGAGGAATGG + Intronic
1062171433 9:135137070-135137092 CAGAGGGAAGACATGAGGACCGG + Intergenic
1203347092 Un_KI270442v1:42668-42690 CAGAGCAGAGAGGAGTGGAGTGG + Intergenic
1185574958 X:1163956-1163978 CAGAACAGAGAAAAGAGGCCAGG + Intergenic
1185825316 X:3243739-3243761 GAGAGGAAAGAAAAGAGGAAAGG + Intergenic
1185830108 X:3293337-3293359 AAGAGGAAAGAGAAGAGGAGAGG + Intergenic
1185830182 X:3294230-3294252 AAGAGGAAAGGGAAGAGGAGAGG - Intergenic
1186129020 X:6446349-6446371 AAGAGCAAACAGAAGGGGAAGGG - Intergenic
1187199670 X:17122916-17122938 CAGAGCAAAGAAACCAGGAAAGG + Intronic
1187645012 X:21337967-21337989 CAGAGCAAAAAGAACTGAACTGG + Intergenic
1188225035 X:27586863-27586885 AAGAGCAATTAGAACAGGACAGG - Intergenic
1188949889 X:36358085-36358107 CAGAGCAAAGAATCAAGGACAGG - Intronic
1189000305 X:36937147-36937169 GAGAGAAAAGAAAAGAGGAAGGG + Intergenic
1189038098 X:37513464-37513486 CACAGCAGAGAGAAAAGGAAGGG - Intronic
1189511975 X:41672002-41672024 TAAAGCAAAGAAAAGAGGACTGG - Intronic
1189757882 X:44290127-44290149 CAGAGCAATGAGATGATGGCAGG - Intronic
1190291771 X:48997730-48997752 CAGAACAGGGAGAAGAGGAGGGG + Intronic
1190409981 X:50127093-50127115 CATAGCAAATAGAAAAGGAGAGG + Intergenic
1190500347 X:51070054-51070076 AACAGCAAAGAGAAGAGAGCTGG + Intergenic
1190984011 X:55484373-55484395 CAGAGAAAAGAGCACAGGCCTGG - Intergenic
1191030973 X:55971112-55971134 CTGAGCAAAAAGAAGAAAACTGG + Intergenic
1191909572 X:66134240-66134262 CAGAGCAAAAAGAACAAAACTGG - Intergenic
1192062359 X:67840940-67840962 CTGAGCAAAAAGAAGAAAACTGG + Intergenic
1192137913 X:68621648-68621670 CTGAGCAAAAAGAATAGAACTGG - Intergenic
1192219495 X:69187783-69187805 CAGAGCCCAGAGCTGAGGACTGG + Intergenic
1192232729 X:69277275-69277297 CAGTGTAAGGAGAAGAGGAGAGG + Intergenic
1192528221 X:71866376-71866398 CAGAGCAAGGAGCAGAAGGCTGG - Intergenic
1192617524 X:72643148-72643170 CAGAGAAAAGGGAAGGAGACTGG + Intronic
1193663776 X:84289909-84289931 CTGAGCAAAAAGAAGAAAACTGG - Intergenic
1194022328 X:88707245-88707267 CAGAGTCAAGAGAAGAAGAAGGG + Intergenic
1195123701 X:101783203-101783225 CAGAGCAAAGAGAGGAGAATGGG - Intergenic
1195323154 X:103737314-103737336 CAAAGCACAAAGCAGAGGACAGG - Intergenic
1195666951 X:107440439-107440461 CTGAGCAAACAGAAGAGGGAGGG + Intergenic
1195724426 X:107899544-107899566 AAGAGCAAAGAGCAGAGAAGAGG + Intronic
1195904567 X:109830679-109830701 CAGAGCATAGAGGAGTGGAAAGG + Intergenic
1195930058 X:110065424-110065446 CAGTACACAGAGAAGAGGAAGGG - Intronic
1195939813 X:110158730-110158752 GAGAGGAAAGTGAAGAGGCCTGG + Intronic
1196055976 X:111355698-111355720 CAGAGCCAAGAGAAGGGGAAAGG + Intronic
1196060407 X:111402296-111402318 CAGAGGCAAGAGGAGGGGACTGG + Intronic
1196072102 X:111536733-111536755 AAGAGCAAACAGAAGAGAACAGG + Intergenic
1197436985 X:126442092-126442114 CTGAGCAAAAAGAAGAAAACTGG - Intergenic
1198785475 X:140283385-140283407 AAGAGCAAAGCGAAAAGTACAGG - Intergenic
1198927043 X:141809540-141809562 CAAAGCAAAAAGAACATGACTGG - Intergenic
1199633956 X:149797449-149797471 CAGAGAAAATAGAAGAGAAGGGG - Intergenic
1199902415 X:152189538-152189560 GAGGGCAAAGAAAAGAGGGCAGG - Intronic
1200687907 Y:6273567-6273589 GAGAGAACAGAGAAGAGGCCAGG - Intergenic
1200834295 Y:7717961-7717983 CAGGGGAAAGAGAAGAAGTCTGG - Intergenic
1201247756 Y:12022961-12022983 CAGAGGAAAGGGAAGAGGAGAGG + Intergenic
1201247866 Y:12024172-12024194 AAGAGGAAAGAGAAGAGGAGAGG - Intergenic
1201917899 Y:19202574-19202596 AAGAGAAGAGAGAAGAGGAGAGG - Intergenic