ID: 975841064

View in Genome Browser
Species Human (GRCh38)
Location 4:78474742-78474764
Sequence TTGTTTTTCACCACTGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 341
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 305}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975841064_975841068 5 Left 975841064 4:78474742-78474764 CCATCCTCAGTGGTGAAAAACAA 0: 1
1: 0
2: 1
3: 34
4: 305
Right 975841068 4:78474770-78474792 AGCTCATGCCCTACTTTCTGTGG 0: 1
1: 0
2: 0
3: 15
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975841064 Original CRISPR TTGTTTTTCACCACTGAGGA TGG (reversed) Intronic
900686512 1:3951795-3951817 TTGCTGTTCCCCACTGGGGAAGG - Intergenic
901202356 1:7473822-7473844 TAGTTTTTCTCCACTGACGCCGG + Intronic
901722883 1:11214370-11214392 TTGCTTTGCAGCACTGAGGCAGG - Intronic
902213278 1:14918950-14918972 TTGTTTTAAACCACTGAGTTTGG + Intronic
903544988 1:24118443-24118465 TTGTTTTTCACCAATAAACAAGG + Intergenic
904003592 1:27351654-27351676 TGGGCTTTCACCACTGAGCAGGG + Intronic
906804783 1:48770171-48770193 CAGTTTTGCACCACAGAGGAAGG - Intronic
907824180 1:57999600-57999622 TTGTTTATCACAACTGAGGTGGG + Intronic
908402652 1:63786026-63786048 TCCTTTTTCCCCACTGAGGAAGG + Intronic
908598069 1:65709705-65709727 TTTTATTTAACCACTGAGAAAGG + Intergenic
908605818 1:65795790-65795812 TTGTTATCCACACCTGAGGAAGG - Intronic
908743169 1:67349430-67349452 TTGTTTTTCTCCTCTGACAAAGG + Intronic
909192310 1:72569423-72569445 TTTTTTTTAACCAGAGAGGATGG + Intergenic
909294455 1:73929453-73929475 TTGTTTTTGAGCACTGAAAAGGG + Intergenic
909430931 1:75587061-75587083 TTGTATGTCACAACTGAAGAGGG + Intronic
910483477 1:87684051-87684073 TTGTTTTTCTCATCAGAGGAAGG - Intergenic
911349159 1:96731276-96731298 TTGTTTTTCACAAGTGTGTATGG + Intronic
914426783 1:147585096-147585118 TTGGATTTTACCACAGAGGAGGG + Intronic
918271951 1:182910482-182910504 TTTTTTTTCACCCCTCAGGTTGG + Intronic
918678185 1:187316774-187316796 CAGTTTTTCACCATTGAGTATGG - Intergenic
919066527 1:192698071-192698093 TTGCTTATCACAACTGGGGAGGG - Intergenic
920266544 1:204728091-204728113 TTATTTTTCACATCTGAGGCAGG - Intergenic
920723728 1:208414104-208414126 TTGGTTGTCACAACTGGGGAGGG + Intergenic
921348860 1:214215203-214215225 TTATTTTTCACCCCTGGGTATGG + Intergenic
923560161 1:235033383-235033405 TTATTTTTAACCTCTGAAGAGGG + Intergenic
924186387 1:241495682-241495704 TTGGTTGTCATCACAGAGGAGGG - Intergenic
924403458 1:243715790-243715812 TTTTTTTTCTCCACTAAGAATGG - Intronic
924854387 1:247861362-247861384 TTGGATGTCACAACTGAGGAGGG + Intronic
1063499577 10:6540952-6540974 TTGTATTTCCCTACTAAGGAAGG + Intronic
1064460673 10:15532119-15532141 TTGATTGTCACAACTGAGGGAGG - Intronic
1064869349 10:19920437-19920459 ATGTGTTCCTCCACTGAGGATGG + Intronic
1064955773 10:20907751-20907773 GTGTTTTTCCTCACTGATGAAGG - Intronic
1065552963 10:26887650-26887672 TTGCTATTCTCCAGTGAGGAAGG + Intergenic
1066701322 10:38132200-38132222 TAGTTTTTCACCACTGATTATGG + Intergenic
1069570989 10:69494262-69494284 TTGTTTTCCACCAATGACGTGGG + Intronic
1070249906 10:74764758-74764780 TTGTTATAAACCACTGAGGTTGG - Intergenic
1071378464 10:85034039-85034061 CAGTTTTTGACCACTCAGGATGG - Intergenic
1072174564 10:92905679-92905701 TTGTTTCTCACCATTAAGTATGG + Intronic
1072367072 10:94722698-94722720 TTGTTTTTCTCCACAGAAAAGGG + Intronic
1074930698 10:118122957-118122979 TTATTTGTCACCAATGATGAAGG + Intergenic
1075418776 10:122285579-122285601 TTGGTTGTCACCGCTGGGGAGGG + Intronic
1076486328 10:130821022-130821044 CTGTTTTGCGCCACTGAGGCTGG - Intergenic
1076602393 10:131667269-131667291 TGGTCTTTCACCACTGACCAGGG + Intergenic
1076618746 10:131773495-131773517 CTGGTTGTCACCCCTGAGGAGGG + Intergenic
1076942551 10:133619418-133619440 TGGGTTTTCCCCAATGAGGAAGG - Intergenic
1077975314 11:7242189-7242211 TTGTTTTCTACTTCTGAGGATGG - Intronic
1077975460 11:7243684-7243706 TTCATTTTCATCACTGGGGATGG + Intronic
1078945574 11:16064908-16064930 CTGTTTTTCTCCATTGAGTATGG - Intronic
1079491922 11:20998466-20998488 TTTTTTTTCCACAGTGAGGATGG + Intronic
1080360567 11:31508796-31508818 TTTTTTTTCAAAACTGAGCAGGG - Intronic
1080401358 11:31939342-31939364 TTGTTTTACACCACTCAGTTTGG - Intronic
1080815390 11:35751347-35751369 TTTTTTTTCACCAATGATCATGG + Intronic
1081219103 11:40438143-40438165 CTGTTTTTCACCACTAGGCATGG + Intronic
1081348487 11:42019732-42019754 TTTTTTTTCTCCACTCATGAGGG - Intergenic
1085710546 11:78825287-78825309 TTATTTTTCACAACTGTGTAAGG - Intronic
1085887147 11:80534500-80534522 TTTTTTTTTTCCACTGTGGATGG + Intergenic
1086024746 11:82277307-82277329 TTATTTTACACGATTGAGGAGGG + Intergenic
1086211453 11:84325110-84325132 CAGTTTTTCACCATTGAGTATGG + Intronic
1088318788 11:108533773-108533795 TTGGTTTCCACAACTGAAGAGGG - Intronic
1088400240 11:109415783-109415805 TTGGTTGTCACAACTGGGGAGGG + Intergenic
1088633556 11:111797544-111797566 TTGTTTTACGCCACTAAGTATGG + Intronic
1088980160 11:114855571-114855593 TTGTTTTACACCACTAAGTTTGG - Intergenic
1089057857 11:115601308-115601330 ATTTTTTTCCCCACCGAGGATGG + Intergenic
1091126030 11:133098714-133098736 TAGTTTCTCACCACTAAGTATGG - Intronic
1091207830 11:133833245-133833267 TTGTTTTTCCCCTCTCGGGATGG + Intergenic
1091566173 12:1649781-1649803 TTGTTTCTCACCTCAAAGGATGG - Intergenic
1091934336 12:4423306-4423328 TTGGTTGTCACAACTGGGGATGG - Intergenic
1094200574 12:27791319-27791341 TTGTCTTTCACCTCTCAGAATGG - Intronic
1096850529 12:54432847-54432869 TTGCCTTTCCCCACTGGGGATGG + Intergenic
1096901878 12:54891600-54891622 ATGTTTTTCTCTACTCAGGAGGG + Intergenic
1096910102 12:54974603-54974625 CTGTTTTTCAACTCTTAGGACGG - Exonic
1097680330 12:62642951-62642973 TTGTTTTCCACTACTGAGTTGGG + Intergenic
1100037545 12:90271449-90271471 TTGGTTTTCACAACTGTGCATGG - Intergenic
1100132187 12:91509472-91509494 ATGTGTGTCTCCACTGAGGATGG + Intergenic
1103259807 12:119576922-119576944 TTGGTTGTCTCAACTGAGGATGG + Intergenic
1104101369 12:125615768-125615790 TTGTTTTTTACCACTGTGAGTGG + Intronic
1104189125 12:126461077-126461099 ATTTTTTTCACGTCTGAGGATGG - Intergenic
1106029472 13:25987107-25987129 TTGTTTTTTTCCACTGGGAAAGG + Intronic
1106352876 13:28951387-28951409 TAGTCTTTCACCACTGAGTATGG + Intronic
1106739984 13:32630366-32630388 TTGGTTGTCACAACTGGGGATGG + Intronic
1107448044 13:40485440-40485462 TCATTTTTCCCCACTGATGAGGG - Intergenic
1109630733 13:65042824-65042846 ATGTTTTTCACACTTGAGGATGG + Intergenic
1111165743 13:84455440-84455462 TTGTGTTCCACCACTAGGGAAGG + Intergenic
1111355444 13:87095087-87095109 TATATTTTCTCCACTGAGGATGG + Intergenic
1111760445 13:92457418-92457440 TTGATTCTCACAACTGGGGAAGG - Intronic
1113756536 13:112815530-112815552 TTTTATTTCATCAGTGAGGAAGG - Intronic
1113813460 13:113155806-113155828 TTGTTTTTCAGAACAGAAGAGGG + Intergenic
1115846835 14:37545392-37545414 TAGTTTTTAACCACTAGGGAAGG + Intronic
1121300415 14:92866259-92866281 TTGTTTTACATCACTGAGTTTGG - Intergenic
1121374615 14:93396932-93396954 TTGTCAGTCACCACTGAGTATGG + Intronic
1125214328 15:37252896-37252918 ATGTATTTAACTACTGAGGAAGG + Intergenic
1126468689 15:48984056-48984078 TTGATTGTCACAACTGAAGAAGG - Intergenic
1126951112 15:53882807-53882829 GTGTTCTTCTCCACTGAGGATGG + Intergenic
1129012612 15:72436178-72436200 CAGTTTTTCACCACTGAGTATGG + Intergenic
1129334792 15:74845380-74845402 ATGTTTTTCACCACTGCAGTTGG - Intronic
1129504144 15:76066985-76067007 TTGGTTGTCACCACTGGGGACGG - Intronic
1129877107 15:78982889-78982911 TTTTTTTTCCCCAAAGAGGATGG + Intronic
1130060081 15:80563428-80563450 TTGTTTCTCACAAATCAGGAGGG - Intronic
1131692209 15:94839734-94839756 TTGTTTTTTACCATTGAAGCAGG - Intergenic
1131749133 15:95487157-95487179 TTTCTCTTCATCACTGAGGAAGG - Intergenic
1131786684 15:95920966-95920988 TTGACTCACACCACTGAGGAAGG + Intergenic
1133108013 16:3526334-3526356 TTCTTCTTCACCACTGTGTAAGG - Intronic
1133901041 16:9974938-9974960 TCAATTTTCACCACTGAGTATGG + Intronic
1135954640 16:26946001-26946023 TTGGTTTTCACATCAGAGGAGGG - Intergenic
1136710903 16:32235437-32235459 TTGTTCTTCATCACAGAGGTGGG - Intergenic
1136757007 16:32693974-32693996 TTGTTCTTCATCACAGAGGTGGG + Intergenic
1136811102 16:33176401-33176423 TTGTTCTTCATCACAGAGGTGGG - Intergenic
1136817578 16:33286481-33286503 TTGTTCTTCATCACAGAGGTGGG - Intronic
1136824142 16:33343010-33343032 TTGTTCTTCATCACAGAGGTGGG - Intergenic
1138140801 16:54566954-54566976 TTGGTTGTCACAACTGGGGATGG - Intergenic
1138282931 16:55785864-55785886 GTGAGTTTCACCACTGAGGTAGG + Intergenic
1138826017 16:60321039-60321061 TTGTCTTTCATCTCTAAGGATGG - Intergenic
1139343942 16:66289989-66290011 TTGTTTGTCACAACTGGGGATGG + Intergenic
1140388436 16:74563318-74563340 TTCTTTTTCACCTCTGATGTAGG - Intronic
1141680250 16:85539607-85539629 TTGTTTTTCTCCACTGTTGGAGG + Intergenic
1141866774 16:86755700-86755722 GTGTTCTTCACCACTGCGCAGGG + Intergenic
1203059156 16_KI270728v1_random:954325-954347 TTGTTCTTCATCACAGAGGTGGG + Intergenic
1143848508 17:9791500-9791522 TTGTAATTAACCACTGGGGAGGG - Intronic
1144362551 17:14508989-14509011 TTATTTCTCACAACTGTGGAGGG - Intergenic
1144558818 17:16304972-16304994 TTGATTGTGACAACTGAGGAGGG - Intronic
1149140853 17:53431334-53431356 CTTGTTTTCACCACAGAGGATGG + Intergenic
1151078551 17:71301893-71301915 TTATTTTACACCACTGAGTATGG + Intergenic
1151378016 17:73704852-73704874 TTGTTTTAAACCATTGAGCATGG + Intergenic
1152024052 17:77797236-77797258 TTTTTTTTCAAGAGTGAGGAGGG - Intergenic
1152391813 17:80008005-80008027 TTTTTTATCACAACTGAGGGTGG - Intronic
1152500205 17:80703125-80703147 TTGTTCTTCACCACTATGCATGG + Intronic
1153236628 18:2994739-2994761 TTGGCTGTCACCACTGGGGAGGG - Intronic
1155569521 18:27176366-27176388 TTGTTTTTCTACACAAAGGATGG + Intronic
1155596096 18:27489295-27489317 TTGCTTTTCACTATTCAGGAGGG + Intergenic
1155889367 18:31247380-31247402 TCGTTTTTCACCACTGCTTAAGG - Intergenic
1157972095 18:52282591-52282613 ATTTTTCTCACCACTGAGAAAGG - Intergenic
1158673176 18:59495165-59495187 TTCTTTTTTTCCCCTGAGGATGG + Intronic
1158955656 18:62535422-62535444 TTGTTTTACACCACTAAGTTTGG - Intronic
1159040089 18:63317269-63317291 TTGTTTTTCACCACTCAGAGTGG - Intronic
1159873177 18:73781575-73781597 TTGCCTTTCAGGACTGAGGATGG - Intergenic
1160301895 18:77689452-77689474 TTTTTTTTAACCAGGGAGGAAGG + Intergenic
1162566271 19:11447075-11447097 CTGTGTGTCCCCACTGAGGAGGG - Exonic
1163092600 19:15031253-15031275 TTGGTTGTCACAACTGGGGATGG + Intergenic
1164240583 19:23384823-23384845 GTATTTTTGACCACTGAGGAGGG - Intronic
1164478111 19:28590687-28590709 TTGGTTGTCACCACTGGAGATGG - Intergenic
1165675120 19:37716018-37716040 TTGTTTTTCACCTCTGAAGGAGG + Intronic
1167348447 19:48961256-48961278 TTTTTTTTCCCCACTGAGAAGGG + Exonic
1168184692 19:54692039-54692061 TTCTTTATCACCACTTAGAAAGG + Intronic
1168389068 19:55991115-55991137 TTGTTTTTCTGGAGTGAGGAGGG + Intergenic
925901605 2:8513125-8513147 TTGGTTTTCACCACGGGGAATGG - Intergenic
926265935 2:11320734-11320756 TTGTTTTTCTCCTCTCAGGGAGG - Intronic
927808422 2:26168568-26168590 TTTTTTTTATCCAGTGAGGAAGG + Intergenic
929134985 2:38615024-38615046 TTGATTGTCACTACTGAGGATGG - Intergenic
929698672 2:44142378-44142400 TTGATTTTCACAACTGAGGGGGG + Intergenic
929741793 2:44610054-44610076 CTCTTTTTCCCCACTAAGGAAGG + Intronic
930107279 2:47650234-47650256 ATGTTTTTCTCCACCGGGGAAGG - Intergenic
930898722 2:56477406-56477428 TTGTCTTTCACCATTAAGCATGG + Intergenic
931081529 2:58777523-58777545 TTGATTGTCACAACTGAGGGAGG - Intergenic
931825794 2:65999489-65999511 TTGTTCTTCAGCACTTAGCATGG - Intergenic
932701727 2:73996821-73996843 TTTTTATTAACCACTGAGGGAGG + Intronic
933095624 2:78175505-78175527 TTTTCTTTCACTAATGAGGAAGG - Intergenic
933112365 2:78419769-78419791 TTTTTTTTCACCACTGAAGTGGG + Intergenic
933159286 2:79006715-79006737 TTGGTCTTCCCCACTGATGATGG - Intergenic
933236399 2:79869797-79869819 TTGTTTTTCACCACTGCAGGTGG + Exonic
933240691 2:79917433-79917455 TAGTTTTTCACCTCAGAGAAAGG - Intronic
934043175 2:88147084-88147106 TTTGTTTTCTCCACTTAGGATGG + Intergenic
936880668 2:117246681-117246703 TTTTTTTTTACTACAGAGGAAGG - Intergenic
938772373 2:134511390-134511412 TTGTGTTTTTCCACTAAGGATGG + Intronic
938810644 2:134849708-134849730 ATGTTTTTCACTTCTGAGCAAGG - Intronic
939972812 2:148681259-148681281 TTTTTTTTTTCCACTTAGGATGG + Intronic
941148242 2:161880793-161880815 TTGTGTTCCACCACTTAGGAAGG + Intronic
941885144 2:170520147-170520169 TTGTTTGTCACAACTTTGGAGGG + Intronic
943850542 2:192716425-192716447 TTGTTTTTCTCCACTGTGTGTGG - Intergenic
944689039 2:202142982-202143004 TTGATTGTCACAACTGGGGAGGG - Intronic
945011564 2:205469413-205469435 TTGGTTCTCACCACTGGGCAAGG + Intronic
946965431 2:225031994-225032016 TTGTATTTCACCTGTGAAGATGG - Intronic
1169703866 20:8480548-8480570 TTCTGTGTCACCAATGAGGAGGG + Intronic
1169755574 20:9039798-9039820 TTGTTTTAAGCCACTGAGGCTGG + Intergenic
1172862309 20:38064227-38064249 TTGTTTCCCATCCCTGAGGAGGG + Intronic
1173269050 20:41514917-41514939 TTCTTTTTCTCCACTGGGGTTGG + Exonic
1173488135 20:43456693-43456715 TTGTTTGTCACGACTGGGGGAGG - Intergenic
1173948250 20:46968706-46968728 TTGGTTATCACCAATGGGGAGGG - Intronic
1174414633 20:50358727-50358749 TTAGTTTTCACAACTGGGGAAGG - Intergenic
1174886834 20:54345008-54345030 TTGGTTGTCACCACTGGGGTGGG + Intergenic
1175024799 20:55890484-55890506 TTGGTTGTCACAACTGAAGAGGG - Intergenic
1175603750 20:60295927-60295949 TTCTTCTTAACCACTGATGAAGG - Intergenic
1175893633 20:62326568-62326590 CTGTTTTCCACCACGGAGAATGG + Intronic
1177088918 21:16741799-16741821 TCTTTTTTAAACACTGAGGAAGG - Intergenic
1178698311 21:34813140-34813162 TTGGTTGCCACAACTGAGGAAGG + Intronic
1178819000 21:35958238-35958260 TTGCTTTTCATGACTGAGCAAGG - Intronic
1179596590 21:42446816-42446838 CTGATTGTCACAACTGAGGATGG - Intronic
1179936150 21:44604687-44604709 CAGCTTTTCACCACTGAGTATGG + Intronic
1180205959 21:46260709-46260731 GTGTCTTGCACCACTGAGGATGG - Intronic
1180305593 22:11120608-11120630 TAGTTTTTCCCAACTGAGGTTGG - Intergenic
1180544112 22:16482787-16482809 TAGTTTTTCCCAACTGAGGTTGG - Intergenic
1180817855 22:18803429-18803451 TTGTTTTAAGCCACTGAGGTTGG + Intergenic
1180831273 22:18907617-18907639 TTGGTTTTCACGACTAGGGAGGG - Intronic
1181083213 22:20427424-20427446 TCGTTTGACACCACTGATGAAGG - Exonic
1181204070 22:21237882-21237904 TTGTTTTAAGCCACTGAGGTTGG + Intergenic
1181349688 22:22245914-22245936 TTGTTTGTCACAACTGGGAAGGG - Intergenic
1181446795 22:22982878-22982900 TTGGTTGTCACAACTGAGTAGGG - Intergenic
1181812298 22:25410928-25410950 TTATTTTTCACCACTCATGAGGG - Intergenic
1182303855 22:29354440-29354462 TTGGTTTTCACAGCTGAGGGGGG - Intronic
1182909652 22:33971658-33971680 TTGTTTTACACCACTCAGCGTGG - Intergenic
1203222851 22_KI270731v1_random:57533-57555 TTGTTTTAAGCCACTGAGGTTGG - Intergenic
1203267978 22_KI270734v1_random:29280-29302 TTGTTTTAAGCCACTGAGGTTGG + Intergenic
949107676 3:220137-220159 TTGTTTTTAAAGACTGGGGAGGG + Intronic
949169948 3:985946-985968 TTGTTTTTGACCACTCAGAGAGG + Intergenic
950814223 3:15681795-15681817 TTGTTTATCACAACTGAAGGTGG + Intronic
952280443 3:31918151-31918173 GTGTTTTTAATAACTGAGGAGGG - Intronic
954589207 3:51766166-51766188 CTGTTTTTCAGCACTTTGGAAGG - Intergenic
954840180 3:53504695-53504717 TTTTTTTTTAGCACAGAGGAGGG + Intronic
955171648 3:56571571-56571593 TGGTATTTCACCACTCAGGATGG + Intronic
955235187 3:57132818-57132840 TTTTTTTTCATCACTGAGTGTGG + Intronic
955854137 3:63255115-63255137 TTGTTTGTCACGACAGGGGAAGG - Intronic
955981795 3:64534760-64534782 TTGTTTGTCACAACTGTGGGGGG + Intronic
956435166 3:69228094-69228116 TTGATAGTCACAACTGAGGAAGG + Intronic
956646930 3:71465553-71465575 CTGTTTTACATCACTGAAGATGG + Intronic
957907191 3:86572580-86572602 CAGTTTTTCACCACTTAGTATGG + Intergenic
958946561 3:100368954-100368976 TTTATTTTGGCCACTGAGGAAGG - Intronic
960836666 3:121913721-121913743 TTATTTTTCACCACTGGTAATGG - Intronic
964157675 3:153605261-153605283 TTGTTTTTCAATTCAGAGGAAGG + Intergenic
964863886 3:161232150-161232172 TTTTTTTTAACCACTGCTGATGG + Intronic
965055712 3:163712050-163712072 TTATTTTTCACCCCTTAAGATGG - Intergenic
966811371 3:183847905-183847927 TTGTATATCTCCACTTAGGAGGG + Intronic
967767918 3:193302334-193302356 TTTGTTTTCAACACTGAGGATGG + Intronic
968956161 4:3720970-3720992 TGGGTTTTCAACACAGAGGAAGG - Intergenic
969956475 4:10896206-10896228 TGGTTTTTATCAACTGAGGATGG - Intergenic
971354077 4:25878789-25878811 TTGGTTGTCACAACTGGGGATGG + Intronic
971500377 4:27312164-27312186 TAGTTTCTCAGCACTGTGGAAGG - Intergenic
972062139 4:34888912-34888934 TTGTTTTTCATAACTGGGGCAGG - Intergenic
974578975 4:63769932-63769954 TTGGTTGTCACAACTGAGGTAGG - Intergenic
975440343 4:74403137-74403159 CTGTTTTTAACTACTGTGGATGG + Intergenic
975812918 4:78188195-78188217 TTCCTTTTCTCCACAGAGGAAGG - Intronic
975841064 4:78474742-78474764 TTGTTTTTCACCACTGAGGATGG - Intronic
976125204 4:81827085-81827107 TTGTTTGTCATGACTGAGGTAGG - Intronic
977531551 4:98206665-98206687 TTGGTTTTCACAAGTGGGGAGGG - Intergenic
978771348 4:112459215-112459237 TAGTATTTTACCACTGAAGAAGG + Intergenic
979317853 4:119287055-119287077 TTGTCTTGCACCACTGAGTTGGG + Intronic
979525199 4:121708835-121708857 TTGTTTGTCACAACTGGAGAGGG - Intergenic
979527351 4:121731310-121731332 TTGGTTGTCACAACTGGGGACGG + Intergenic
981888805 4:149712579-149712601 TCCTATTTAACCACTGAGGATGG + Intergenic
982095339 4:151917094-151917116 TTGTTATTCAACACAGAGCATGG - Intergenic
982347788 4:154379952-154379974 TTGGTTGTCACAACTGGGGAAGG + Intronic
987106018 5:14640366-14640388 TTGTTTTGGACCACGGAGCATGG - Intergenic
987149214 5:15021839-15021861 TTGGTTGTCACCACTGGGCAGGG + Intergenic
987443778 5:17990488-17990510 TTATGTTTCAGCACTGAAGAAGG + Intergenic
987956651 5:24749696-24749718 TTGTTTTTCACCAATGTAGTAGG + Intergenic
988726700 5:33933622-33933644 TTGTTTTTCAACACAGGGGTGGG - Intergenic
988959003 5:36350354-36350376 TTGATTGTCACTACTGAGCAGGG - Intergenic
989106068 5:37864364-37864386 TTGGTTGTCACAACTGGGGAGGG - Intergenic
989411531 5:41124881-41124903 TTGTTTTTCACATCTCAGCATGG - Intergenic
992286354 5:75239525-75239547 TGGTGTTTCAACACTGATGAGGG - Intergenic
992406719 5:76465447-76465469 CTGTATTTCACCACTGAGTATGG - Intronic
993801106 5:92338629-92338651 TTCTTTTTCTCCACTGTGGTGGG + Intergenic
994468703 5:100174227-100174249 TTGTCTCTCACCACTGAGTCTGG + Intergenic
995731362 5:115246053-115246075 TAATTTTTCACCACTTAGGCCGG + Intronic
996164874 5:120211863-120211885 TGGTTTTTGACCACTCAGCAAGG + Intergenic
996268722 5:121576801-121576823 ATGTTTGTCACTACTGAGAATGG + Intergenic
997275804 5:132587766-132587788 TTGTTTTTTTCCAATGTGGATGG - Intronic
997575711 5:134975424-134975446 TTGTTTTTCCCCACAGAGACAGG - Intronic
998565242 5:143210804-143210826 TTAATTTTCACCTCTGAGCATGG - Intronic
999376719 5:151091842-151091864 TTCATTGTCACAACTGAGGAGGG + Intronic
1000329810 5:160197668-160197690 TTGGTTGTCATAACTGAGGAGGG - Intronic
1001310702 5:170608208-170608230 TTGCTTTTCGGCTCTGAGGATGG - Intronic
1001871237 5:175157719-175157741 TTGTTTTTTAACACTGGGGTGGG - Intergenic
1002651112 5:180695363-180695385 CAGTCTTTCACCACTGAGTATGG - Intergenic
1003004506 6:2368659-2368681 TTGGTTGTCCCAACTGAGGAGGG + Intergenic
1003604901 6:7550546-7550568 TTCTTTTTAACCACCGATGAAGG + Intronic
1004142395 6:13031005-13031027 TTGATTGTCACCACTGGGGTGGG - Intronic
1004678027 6:17863377-17863399 TTTTTTTTTAACACTGAGAAGGG + Intronic
1004710572 6:18166256-18166278 TTGTTTTTCAGCCATAAGGATGG + Exonic
1006585091 6:35104676-35104698 TTCTTTTTCACCACTGGGCATGG - Intergenic
1007233559 6:40371244-40371266 TAGTTTTTCACCATTGAGTATGG + Intergenic
1008075099 6:47137652-47137674 ATGTATTTCCCCACTAAGGATGG + Intergenic
1009302379 6:62041392-62041414 TTCTTTTCTACCACTGAGGATGG - Intronic
1009316305 6:62225056-62225078 TTATTTTTCATAACTGAGGAAGG + Intronic
1010140195 6:72605214-72605236 TCGTTTTTGACCTCTGAGGGAGG + Intergenic
1010158757 6:72826786-72826808 ATGTTTTATACCACTGTGGAAGG - Intronic
1011230162 6:85151719-85151741 CAGTTTTTCACCATTGAGTATGG + Intergenic
1011231452 6:85166043-85166065 TTGTTTTTAAACTTTGAGGAAGG - Intergenic
1011497309 6:87949424-87949446 TTGTTTGTCACAACTGGGGCAGG + Intergenic
1014353517 6:120374402-120374424 TTGTTTTCCACCACATAGTAAGG - Intergenic
1014736615 6:125101464-125101486 TTGTAAATCACCACTGAGCAAGG + Intergenic
1015043335 6:128747837-128747859 TTTTTTTTAACAACTGATGAAGG + Intergenic
1016039783 6:139421119-139421141 TTGGTTGTCACAACTGGGGAAGG - Intergenic
1017283605 6:152649699-152649721 ATGCTTCTCACCACTGAGGTAGG - Intergenic
1019388322 7:770945-770967 TTGTGTTTACCCAGTGAGGATGG - Intronic
1020991109 7:15197057-15197079 TTTTTTTTTTCCACTGAGGCAGG + Intergenic
1021312915 7:19115631-19115653 TTGTTTTTCCCCTCAGAGGAAGG + Exonic
1021883162 7:25113247-25113269 GTTTTTGGCACCACTGAGGATGG - Intergenic
1025090388 7:56058007-56058029 TTGTTTTGGACCACGGAGCACGG + Exonic
1027370373 7:77503295-77503317 TTGTGTTTCAACACTGAACAAGG - Intergenic
1027712848 7:81629720-81629742 TTCTTTTTCACCACTAAGTTTGG - Intergenic
1029223297 7:99007217-99007239 TTGTCTTTCAGCACCTAGGACGG - Intronic
1029625461 7:101717988-101718010 TTATTTGTCTCCACTGTGGAAGG + Intergenic
1031518775 7:122737003-122737025 TTGGGTTTCCCCATTGAGGAAGG + Exonic
1032268439 7:130384050-130384072 TTGGTTGTCACCACTGGAGAGGG - Intronic
1032430070 7:131853698-131853720 TTGTTTTTCAGCACTGGGGTGGG + Intergenic
1032833087 7:135648710-135648732 TTATTTTTTACTAGTGAGGATGG - Exonic
1034030401 7:147756298-147756320 TTTTTTTTCCCCACTGATAAAGG + Intronic
1035114401 7:156510851-156510873 TTGTTTTTCTTCCCTGAGTATGG - Intergenic
1037593148 8:20330286-20330308 GTGTTTTTCAGCATTGAGAATGG + Intergenic
1037648935 8:20819241-20819263 TTTATTTTCACCACTGGGGAGGG - Intergenic
1039715735 8:40106802-40106824 TGGTTTCTGACCACTAAGGAGGG + Intergenic
1041904346 8:63015001-63015023 TTCTTTTTCAGCAAGGAGGATGG + Intergenic
1043629473 8:82310961-82310983 TTATTTGTAAGCACTGAGGAAGG + Intergenic
1044294315 8:90510088-90510110 TTGATCTTCACAACTGGGGAAGG + Intergenic
1045831342 8:106464844-106464866 TTGTTCTGTATCACTGAGGATGG + Intronic
1046268745 8:111865413-111865435 TTTTTTTCCACCTATGAGGAAGG - Intergenic
1047025628 8:120820653-120820675 ATATTTTGCACCACAGAGGAAGG + Intergenic
1047729092 8:127711298-127711320 TTGTTGCTCACCACTGAGCCTGG - Intergenic
1047787231 8:128165545-128165567 TTGTTTTATACCACTAAGGTTGG - Intergenic
1049822399 8:144643869-144643891 TTGTTTTTCACCCAATAGGATGG + Intergenic
1050093410 9:2038991-2039013 TTGTTGTTCACCACTAACCAAGG - Intronic
1052828685 9:33197158-33197180 TTTTTTTTCACACCTGAAGAAGG + Intergenic
1052923553 9:33993210-33993232 TTTTGTTTCAGCACAGAGGAAGG + Intronic
1053133729 9:35636194-35636216 TTGGTTTTCACAACTGGGGAGGG - Intronic
1057282468 9:93722795-93722817 TTCTTTTGCTCCCCTGAGGATGG - Intergenic
1057854955 9:98594713-98594735 TTGACTTTCACCTCTGGGGATGG - Intronic
1058763128 9:108155678-108155700 TAGTTTTTCACCAGTATGGAAGG - Intergenic
1059221877 9:112630067-112630089 GTGTTTCTCACCACTGAAGTTGG + Intronic
1061523376 9:131136618-131136640 TTTTCTTTCATAACTGAGGATGG - Intronic
1185552777 X:997411-997433 TTGGTTGTCACAACTGGGGAGGG + Intergenic
1186279594 X:7977773-7977795 TTGTTTTTTACCACTCAGAGAGG - Intergenic
1186517046 X:10174027-10174049 TTGGTTATCACCTCTGGGGAGGG - Intronic
1186711645 X:12204150-12204172 TTGGTTGTCACAACTGAGGTTGG + Intronic
1186723739 X:12334596-12334618 TTTTTTTTCACCAATGAAGAGGG - Intronic
1186797047 X:13057181-13057203 TTGATTGTCACAACTGTGGAAGG - Intergenic
1186810933 X:13187870-13187892 TGGTTTTTCATCAATGAGAAGGG - Intergenic
1187007159 X:15243759-15243781 TTGTTTGTGACAACTGAGGAGGG - Intronic
1187079676 X:15973521-15973543 TTGCTTGTCACAACTGGGGAAGG + Intergenic
1187572769 X:20521630-20521652 TTGTTTTACACCACTGTGTTTGG - Intergenic
1188064414 X:25640625-25640647 TTGTTTTTGAACAATTAGGAGGG - Intergenic
1188415373 X:29926758-29926780 CTGATTTTCATAACTGAGGAAGG - Intronic
1189026159 X:37396917-37396939 TTGTTTGTCACAACTGGAGAGGG - Intronic
1191008545 X:55737532-55737554 CAGTTTTTCACCACTGAGCATGG + Intronic
1192540756 X:71969870-71969892 CTGTTTTTCACCATTAAGTATGG + Intergenic
1193212075 X:78819075-78819097 ATGTTTTTCAACACTTAGTATGG - Intergenic
1194693162 X:97011577-97011599 TTGTTTTTCAAGAATGAAGAGGG + Intronic
1197252203 X:124227996-124228018 TTTTTTTTCCCCACTGACCAAGG + Intronic
1197263333 X:124339102-124339124 TTTTTTTTTTCCAGTGAGGAAGG + Intronic
1197765392 X:130056730-130056752 TTTTTTTCCCCCACTGGGGAGGG + Exonic
1198131361 X:133698623-133698645 ATATTTTTAACCACAGAGGACGG + Intronic
1199179597 X:144838105-144838127 TATTTTTTCACCACTGAATAAGG + Intergenic
1200771425 Y:7129026-7129048 TTGTTTTTCACCAGTAAGGATGG + Intergenic