ID: 975848051

View in Genome Browser
Species Human (GRCh38)
Location 4:78546210-78546232
Sequence GCAGCCACCCCAGAATCACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975848051_975848056 4 Left 975848051 4:78546210-78546232 CCTTGTGATTCTGGGGTGGCTGC No data
Right 975848056 4:78546237-78546259 CTCCCTGGCCACAGGTGTCACGG 0: 1
1: 0
2: 3
3: 30
4: 227
975848051_975848053 -4 Left 975848051 4:78546210-78546232 CCTTGTGATTCTGGGGTGGCTGC No data
Right 975848053 4:78546229-78546251 CTGCATCCCTCCCTGGCCACAGG No data
975848051_975848057 5 Left 975848051 4:78546210-78546232 CCTTGTGATTCTGGGGTGGCTGC No data
Right 975848057 4:78546238-78546260 TCCCTGGCCACAGGTGTCACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975848051 Original CRISPR GCAGCCACCCCAGAATCACA AGG (reversed) Intergenic
No off target data available for this crispr