ID: 975848053

View in Genome Browser
Species Human (GRCh38)
Location 4:78546229-78546251
Sequence CTGCATCCCTCCCTGGCCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975848043_975848053 14 Left 975848043 4:78546192-78546214 CCTCCCTGCTTCCTTCTGCCTTG No data
Right 975848053 4:78546229-78546251 CTGCATCCCTCCCTGGCCACAGG No data
975848042_975848053 17 Left 975848042 4:78546189-78546211 CCTCCTCCCTGCTTCCTTCTGCC No data
Right 975848053 4:78546229-78546251 CTGCATCCCTCCCTGGCCACAGG No data
975848044_975848053 11 Left 975848044 4:78546195-78546217 CCCTGCTTCCTTCTGCCTTGTGA No data
Right 975848053 4:78546229-78546251 CTGCATCCCTCCCTGGCCACAGG No data
975848045_975848053 10 Left 975848045 4:78546196-78546218 CCTGCTTCCTTCTGCCTTGTGAT 0: 1
1: 1
2: 6
3: 426
4: 985
Right 975848053 4:78546229-78546251 CTGCATCCCTCCCTGGCCACAGG No data
975848048_975848053 3 Left 975848048 4:78546203-78546225 CCTTCTGCCTTGTGATTCTGGGG No data
Right 975848053 4:78546229-78546251 CTGCATCCCTCCCTGGCCACAGG No data
975848051_975848053 -4 Left 975848051 4:78546210-78546232 CCTTGTGATTCTGGGGTGGCTGC No data
Right 975848053 4:78546229-78546251 CTGCATCCCTCCCTGGCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975848053 Original CRISPR CTGCATCCCTCCCTGGCCAC AGG Intergenic
No off target data available for this crispr