ID: 975848056

View in Genome Browser
Species Human (GRCh38)
Location 4:78546237-78546259
Sequence CTCCCTGGCCACAGGTGTCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 227}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975848044_975848056 19 Left 975848044 4:78546195-78546217 CCCTGCTTCCTTCTGCCTTGTGA No data
Right 975848056 4:78546237-78546259 CTCCCTGGCCACAGGTGTCACGG 0: 1
1: 0
2: 3
3: 30
4: 227
975848043_975848056 22 Left 975848043 4:78546192-78546214 CCTCCCTGCTTCCTTCTGCCTTG No data
Right 975848056 4:78546237-78546259 CTCCCTGGCCACAGGTGTCACGG 0: 1
1: 0
2: 3
3: 30
4: 227
975848048_975848056 11 Left 975848048 4:78546203-78546225 CCTTCTGCCTTGTGATTCTGGGG No data
Right 975848056 4:78546237-78546259 CTCCCTGGCCACAGGTGTCACGG 0: 1
1: 0
2: 3
3: 30
4: 227
975848042_975848056 25 Left 975848042 4:78546189-78546211 CCTCCTCCCTGCTTCCTTCTGCC No data
Right 975848056 4:78546237-78546259 CTCCCTGGCCACAGGTGTCACGG 0: 1
1: 0
2: 3
3: 30
4: 227
975848045_975848056 18 Left 975848045 4:78546196-78546218 CCTGCTTCCTTCTGCCTTGTGAT 0: 1
1: 1
2: 6
3: 426
4: 985
Right 975848056 4:78546237-78546259 CTCCCTGGCCACAGGTGTCACGG 0: 1
1: 0
2: 3
3: 30
4: 227
975848051_975848056 4 Left 975848051 4:78546210-78546232 CCTTGTGATTCTGGGGTGGCTGC No data
Right 975848056 4:78546237-78546259 CTCCCTGGCCACAGGTGTCACGG 0: 1
1: 0
2: 3
3: 30
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975848056 Original CRISPR CTCCCTGGCCACAGGTGTCA CGG Intergenic
900391317 1:2435226-2435248 CTCACTGTCCGCAGGTGACAGGG - Intronic
900437800 1:2639824-2639846 GTCTCTGGCCACAGGGGTCTGGG - Intronic
900895702 1:5481501-5481523 CTCCCTGGCCACAGCTCTCCTGG + Intergenic
901424483 1:9173098-9173120 TTACCTGGCCTCAGGTGGCAGGG - Intergenic
901944643 1:12691786-12691808 ATCCCTGGCCAGGGGTCTCAGGG + Intergenic
902195071 1:14792260-14792282 CTCCCTGCACACAGGTGACTGGG - Intronic
902746278 1:18476607-18476629 CTCCATGGGCACAGGAGCCATGG + Intergenic
902868475 1:19296962-19296984 CTCCCTGTCCACAGGCTCCATGG - Intergenic
903263262 1:22142617-22142639 CTCCCTGCCCAGAGGCGTCAGGG - Intronic
903369271 1:22824842-22824864 TGCCCTGGCCACAGGTGCCCTGG - Intronic
903673460 1:25050135-25050157 CTCCCTTCCCACAGGTGTCAGGG + Intergenic
904585676 1:31579338-31579360 CTCCCTTGCAAAAGGGGTCAGGG - Intronic
905059420 1:35126739-35126761 CTCCCTGTCCACTGGTTCCAGGG + Intergenic
905617191 1:39409190-39409212 CTCCCCGCCCGCAGCTGTCACGG - Intronic
908014414 1:59815634-59815656 CTACCTGGACACAGGTGGCCAGG + Intronic
908081935 1:60590149-60590171 CTCCCTGGCCAAAGGATTAAAGG - Intergenic
908328187 1:63044239-63044261 CTCCCTAGCCTGAGGTCTCAAGG - Intergenic
912518101 1:110228392-110228414 CTCCCTGGCCTCAGGTCTCCTGG - Intronic
912578970 1:110703429-110703451 ATCCCTGGCCACAAGAATCAGGG - Intergenic
915338035 1:155159061-155159083 CTGGATGTCCACAGGTGTCAAGG + Intergenic
915339793 1:155170597-155170619 CTCCCTGGACACAGGTTGGAGGG + Intronic
918131592 1:181634289-181634311 CTCCCTGGCAAAAGGGTTCAAGG + Intronic
919888840 1:201955371-201955393 CACGCTGGCCACAGGAGTCCTGG + Intergenic
922471236 1:225878560-225878582 CTCCCGGTCCTCTGGTGTCAGGG - Intronic
922874144 1:228926978-228927000 CACCATGTCCACAGGGGTCAGGG - Intergenic
924813639 1:247424489-247424511 CTCCAGGGCCACAGGTCTCGTGG - Exonic
1063248756 10:4251400-4251422 CTTCCTGGTCAGAGGTGTCCAGG + Intergenic
1065268226 10:23999530-23999552 ATCCCTGGCCACCAGTGTCCAGG - Intronic
1067759640 10:49035088-49035110 CACCCTGGTCCCAGGTGTCATGG - Intronic
1070679423 10:78438239-78438261 CTCACAGGCCATAGCTGTCAGGG + Intergenic
1070962125 10:80506687-80506709 CTGTCTGGCCACAGGTATCGTGG - Intronic
1071256266 10:83874633-83874655 GTCCCTGGCCAAAGGTCTCATGG + Intergenic
1071306316 10:84302315-84302337 CTCCATGGCCAGATGTGACAGGG - Intergenic
1071438080 10:85665531-85665553 GTCCCTGGCCAGATGTGGCAGGG - Intronic
1071573802 10:86711738-86711760 CTCCCGGGCCTCAGGTGTTCCGG - Intronic
1071600292 10:86955663-86955685 CTCCCTGGTCACAGGAGCAAGGG + Intronic
1072702257 10:97651170-97651192 CTGCCTGGCCACAGTTTTCCTGG + Intronic
1073459844 10:103660285-103660307 GTCCCTGGCAGCAGGAGTCATGG - Intronic
1073493687 10:103872545-103872567 CCCTCTGGCAACAGGTGTCATGG + Intergenic
1075322119 10:121499749-121499771 CTGTCTTGCCCCAGGTGTCATGG - Intronic
1075350877 10:121723998-121724020 CTCCCTGGCCATAGCTGGCAGGG + Intergenic
1075522519 10:123151461-123151483 CTGCGCGGCCGCAGGTGTCAGGG - Intergenic
1075541690 10:123319010-123319032 CTCCCTGGCTGGAGGTGTGAAGG - Intergenic
1075788753 10:125068511-125068533 CACACAGGCCACAGGTTTCAGGG + Intronic
1075969367 10:126639464-126639486 CTACCTCGCCATGGGTGTCATGG - Intronic
1083880954 11:65548001-65548023 CTCCGTGGCCACAGATGTTCTGG + Exonic
1083932495 11:65853576-65853598 CTTCCTGGGGAGAGGTGTCAGGG - Exonic
1084438208 11:69156254-69156276 CTTCCTGGCCACAGGGATCTGGG - Intergenic
1084472291 11:69370067-69370089 CTCCCTGGCCAAAGCTGACTGGG + Intergenic
1085235202 11:75009287-75009309 CTTCCTTCCCACAGGTTTCAGGG - Exonic
1085530719 11:77190534-77190556 CTCCCTGGACACCTGTGACAGGG + Intronic
1086169138 11:83815760-83815782 CTCCCTGCACACAGGCCTCATGG + Intronic
1089329521 11:117679901-117679923 CTCCCTGGACATCTGTGTCATGG - Intronic
1090078457 11:123594298-123594320 ACCCCTGGCCCCAGCTGTCAGGG + Intronic
1090584843 11:128200374-128200396 CTCCCTGCCAACAGCTGACAAGG + Intergenic
1091049434 11:132354142-132354164 CTCCTTGGCCCCATGTTTCATGG - Intergenic
1094302370 12:28979170-28979192 GACTCTGGCCACAGGTGGCAAGG - Intergenic
1100240414 12:92705607-92705629 TTCCCTGGCCGCAGATGGCATGG - Intronic
1104696353 12:130866982-130867004 CTCCCTGGCTACAGATTTCATGG + Intergenic
1104925311 12:132310916-132310938 CTCCCTGGGCACACGGTTCAGGG + Intronic
1106803811 13:33285564-33285586 CTCCTGGCCCTCAGGTGTCATGG + Exonic
1107017522 13:35719603-35719625 CTCCATGGACACAGGACTCAGGG + Intergenic
1108359473 13:49656203-49656225 CTCCCTGGCAACAAATGTGATGG + Intergenic
1112448968 13:99492328-99492350 CTCCCAGTCCACAAGTGTTATGG - Intergenic
1113811087 13:113143118-113143140 CTCTGTGGCCACACGTGTCTGGG - Intronic
1115174416 14:30546495-30546517 CTCGCTGGCCTCAGGAGTGAAGG + Intergenic
1118506657 14:66420853-66420875 CTGCCTGGCCACTAGTGTTAGGG - Intergenic
1121794742 14:96725523-96725545 TTCCCAGCCCACAGGTGTCCAGG + Intergenic
1123717568 15:23042379-23042401 CCACCTGGCCAGAGGTGCCAGGG + Intergenic
1123718660 15:23046155-23046177 CCACCTGGCCAGAGGTGCCAGGG + Intergenic
1123719601 15:23049393-23049415 CTACCTGGCCAGAGGTGCCGGGG + Intergenic
1123719709 15:23049757-23049779 CCACCTGGCCAGAGGTGCCAGGG + Intergenic
1125748592 15:42013723-42013745 CTCACTGTCAACAGGTGGCATGG + Exonic
1128419699 15:67479913-67479935 CTCCCTTCCCATATGTGTCAAGG - Intronic
1128691233 15:69726336-69726358 CTCCCTAGCCTCAACTGTCATGG + Intergenic
1129161966 15:73752383-73752405 CTCCGAGGCCACAGGTGACCGGG + Exonic
1129832821 15:78681818-78681840 CTCCCTGGCCATATGGCTCAGGG + Intronic
1130150259 15:81306358-81306380 CTCCCAGGCCACAGATGCCCTGG - Intronic
1131327153 15:91459015-91459037 CTCCCTGGCTGCAGCTGTCTGGG - Intergenic
1132356163 15:101173026-101173048 CTGCCAGGCCCCAGGTGGCAAGG - Intergenic
1132644350 16:991911-991933 CTCCCAGGCCACAGATCACAGGG - Intergenic
1132748969 16:1448649-1448671 CTCCCCACCCACAGGTGTCCTGG + Intronic
1134025974 16:10954191-10954213 CTTCCTGGCCACAGGTCTGTGGG + Intronic
1134423127 16:14112832-14112854 CTCCATGGACAGAAGTGTCAGGG + Intronic
1135347117 16:21698572-21698594 CTCACTGGCCAGAAGAGTCAGGG - Intronic
1137696337 16:50464647-50464669 CTCGCAGGCCACATGTGCCAAGG + Intergenic
1138370377 16:56521798-56521820 CTCCCTGACCAGCGGTGCCATGG + Intergenic
1139569014 16:67798900-67798922 CTCCCTGGCCACAGCATACAAGG + Intronic
1139668128 16:68472508-68472530 CAGCCTGGACACAGGTGACATGG + Intergenic
1141457649 16:84154518-84154540 CTCCCAGGGCAGAGGGGTCACGG - Intronic
1141660628 16:85439294-85439316 CTCTCTGGCCACCTGGGTCATGG - Intergenic
1141955976 16:87371552-87371574 GTCCCTGGCCACCGGGGTGATGG - Intronic
1142480359 17:215087-215109 CTCCCTGGCCAGAGGATTCATGG - Intronic
1143409134 17:6697980-6698002 CTCCCTGGCCTCAGGTGGGGAGG + Intronic
1144345382 17:14344963-14344985 CTCTCTGGCCACACGTCTTAAGG - Intronic
1144762701 17:17716269-17716291 TTCCCTGGCCCCAGGGCTCATGG - Intronic
1145984863 17:29038683-29038705 CTCCCTGGCCCCTGGTTCCAGGG - Intronic
1147146805 17:38490261-38490283 CTCCAAGGCCACAGGGGTCGTGG - Intronic
1147215964 17:38899122-38899144 TTCTCTGGCCACAGGTGCCATGG - Intronic
1147306213 17:39566267-39566289 GTCCCTTCCCACAGCTGTCACGG + Intergenic
1147462509 17:40582442-40582464 GGCCATGGCAACAGGTGTCAGGG - Intergenic
1147611835 17:41806463-41806485 CTCCCTGGCCACCTGTGGCCTGG - Intronic
1148124470 17:45229763-45229785 TCCCCTGGCCACAGATGACAAGG - Intronic
1148245980 17:46031133-46031155 TGCCCTGCCCACAGGTGTGAGGG + Exonic
1152517141 17:80832251-80832273 TGCCGTGGCCCCAGGTGTCAGGG + Intronic
1152602726 17:81273021-81273043 CTCCTGGCCCACAGGTTTCAGGG + Intronic
1152750156 17:82058915-82058937 CTGGCTGGCCACAGCTGGCATGG - Intronic
1152896669 17:82915244-82915266 CGCCCTGGCCGCAGGTGCCCCGG + Intronic
1152959883 18:73318-73340 CTCGGTGGCCCCAGGTGTCCCGG + Intronic
1154224899 18:12494436-12494458 CTCCCAGGCCAGAGTGGTCATGG - Intronic
1155167484 18:23243191-23243213 TTCCATGGCCTCAGGTTTCAAGG + Intronic
1155185514 18:23383583-23383605 CTCCCATGCCACAGGCCTCAGGG - Intronic
1160697889 19:493475-493497 CTCCCTGTCCACAGCTGCCGAGG - Intronic
1160866722 19:1259491-1259513 CTCCCCAGCCACAGGAGTCGGGG + Exonic
1161258081 19:3320738-3320760 CTTCCTGGCCACAGACCTCAGGG + Intergenic
1161313386 19:3607019-3607041 CCCCCAGGCCACCGGTGGCAGGG + Intergenic
1161876308 19:6913727-6913749 CTCCCTGGCCACAGTCTTCCTGG + Exonic
1162126402 19:8501949-8501971 CTCCTTGACCACAGGTGAAAGGG - Intronic
1164772064 19:30816865-30816887 GTCACTGGCCACAAGTGACAAGG - Intergenic
1165439502 19:35816558-35816580 CCACCTGCCCTCAGGTGTCAGGG + Intergenic
1166864742 19:45829046-45829068 CTACCTGGCCGCAGGTGCCTCGG - Exonic
1168111129 19:54191773-54191795 CTCCCGGGCCTCAGCTGCCAAGG - Exonic
1168116579 19:54224320-54224342 CTGAGTGGCCACAGGTGTCTGGG + Intronic
1168119562 19:54244103-54244125 CTGAGTGGCCACAGGTGTCTGGG + Intronic
1168168659 19:54572322-54572344 CTGAGTGGCCACAGGTGTCTGGG - Intergenic
925470606 2:4157240-4157262 CTCCCAGGCCACAGCGGACATGG + Intergenic
926205966 2:10834570-10834592 CTCCCAGGCCACAGGAGCCTCGG - Intronic
926762293 2:16288901-16288923 TTCCCTGGCAACAGGTCTCAAGG + Intergenic
927218287 2:20682585-20682607 CTCCCTGGCAAAAGGTGGAAGGG + Intergenic
927519256 2:23689262-23689284 ACCCCTGGCCACAGGAGGCATGG - Intronic
929983162 2:46699400-46699422 CTGCCTGGCCGCAGGTGCCCTGG + Intronic
931162377 2:59705783-59705805 CCCCCAGTCCCCAGGTGTCAAGG - Intergenic
931236127 2:60413850-60413872 CTCCCTGGAAACAGATGTCTTGG + Intergenic
931283908 2:60816952-60816974 CTCCATGGCCACACCTCTCAGGG + Intergenic
932606710 2:73170254-73170276 CGCCCTGTCCCCAGGAGTCATGG - Intergenic
933925714 2:87090181-87090203 CGCCCTGTCCCCAGGAGTCATGG + Intergenic
934758235 2:96839342-96839364 CTCCCTGGCTTCGAGTGTCAGGG - Exonic
938094938 2:128455544-128455566 CTGCCAGGCCACAGTGGTCAGGG - Intergenic
941983899 2:171490768-171490790 CTTCCTGTCCACTGATGTCAAGG - Intergenic
946852381 2:223919859-223919881 CTCCCTGGTCTCAAGGGTCAGGG - Intronic
947712659 2:232324970-232324992 CTTCCTGGCCACAGATGCCCTGG + Intronic
947839474 2:233198355-233198377 CTCCCAGGACACAGGAGTCAAGG + Exonic
948098664 2:235356868-235356890 CTCTATGGTCACAGGTGACATGG + Intergenic
948146097 2:235709256-235709278 CTCCCTTCCCACAGGTGCCAGGG - Intronic
948840625 2:240647147-240647169 CTCCCTGGTCCGAGGTGTCAGGG - Intergenic
948852824 2:240716739-240716761 CTCCATGGCCACATGGGTCCTGG - Exonic
949009515 2:241670572-241670594 GTTCCTGGCCACAGGAGCCAAGG + Intronic
1170219103 20:13922980-13923002 CTCCCTTCCCACAGGTAACAGGG + Intronic
1170547108 20:17443757-17443779 CTCCCTGGCTGCAGGTGAAAAGG + Intronic
1170555956 20:17514835-17514857 ATCCCTGGCCACAGGCACCATGG + Intronic
1170590901 20:17771125-17771147 CTCATTGGCCAGAGGTGTCTTGG - Intergenic
1171381543 20:24737703-24737725 CTCCCTGGACACAGGCGGCATGG + Intergenic
1173207303 20:41005183-41005205 CTCCCTGACCTCAGTTTTCATGG + Intergenic
1173749494 20:45466088-45466110 CTCCCTGGCCCCACCTGTCTTGG + Intergenic
1175744383 20:61445163-61445185 ATCCCTGGCCAGAGGTGGCCAGG - Intronic
1180664318 22:17497738-17497760 CTCCGTGGCTACAGCAGTCATGG - Intronic
1181052816 22:20245793-20245815 CACCCTGGCCCCAGTTCTCACGG + Intronic
1181602940 22:23963116-23963138 CTCCCAGGCCCCAGAGGTCAAGG - Intergenic
1181605574 22:23978191-23978213 CTCCCAGGCCCCAGAGGTCAAGG + Intronic
1181787592 22:25238230-25238252 CTCCCTGGCAACAGGTGACAAGG - Intergenic
1181819333 22:25463268-25463290 CTTCCTGGCAACAGGTGACAAGG - Intergenic
1183302359 22:37064542-37064564 CTCCCTGCACACTGGTGCCAAGG + Intergenic
1185116231 22:48939797-48939819 CTGCCTGGCCACAGGTGCGGGGG + Intergenic
1185233637 22:49698880-49698902 CTCCCTGTCCACAGCTGCCTGGG - Intergenic
1185233645 22:49698907-49698929 CTCCCTGTCCACAGCTGCCTGGG - Intergenic
1185233661 22:49698961-49698983 CTCCCTGTCCACAGCTGCCTGGG - Intergenic
1185233669 22:49698988-49699010 CTCCCTGTCCACAGCTGCCTGGG - Intergenic
1185233923 22:49700121-49700143 CTCCCTGTCCACAGCTGCCTAGG - Intergenic
1185247642 22:49781542-49781564 CTCCGTGCCCTCAGGTGTCTCGG - Intronic
1185292302 22:50033162-50033184 TTCCCTGGCCCGAGGTGTCCAGG + Intronic
1185367120 22:50441812-50441834 CTCTCTGGCCTCTGGGGTCAGGG + Intronic
949138817 3:606403-606425 CTTCGTGACCCCAGGTGTCATGG + Intergenic
951024641 3:17816486-17816508 CTCCCTGACTACTTGTGTCAAGG - Intronic
952932096 3:38368363-38368385 CTTCCTGGCAACAGATGACAGGG - Intronic
953641295 3:44710926-44710948 CTGCCTGGCCTTAGGTGTCCTGG - Intergenic
953794627 3:45975053-45975075 CTACTTGCCCACATGTGTCAAGG + Intronic
953928641 3:46995190-46995212 CTGCCTGCACACAGGTGGCACGG - Exonic
954387507 3:50252011-50252033 CTCCTGGGCTACAGGTGTCTGGG + Intronic
955609878 3:60745624-60745646 CTCCTAGGTCACAGGTGTCTAGG + Intronic
956105140 3:65809670-65809692 CTCCCTGGCCTCAGGGCTCCAGG - Intronic
961507967 3:127383897-127383919 CTCCCTGTTGACAGGTGTCAGGG + Intergenic
962414238 3:135167979-135168001 CTCCCAGGCCAAAGTTCTCATGG + Intronic
962504975 3:136037555-136037577 CTTCCAGGCCACAGGTGTGATGG - Intronic
963717968 3:148825683-148825705 CTCACTGGCCAGGGTTGTCATGG - Intronic
965471764 3:169102158-169102180 CTCACTGGCCTCAGGTTTCAGGG + Exonic
966962533 3:184954371-184954393 TTCCCTCTCCAGAGGTGTCAGGG + Intronic
967000240 3:185327229-185327251 CTCCCTGACCACAGCTGGGAGGG + Intronic
967369262 3:188725243-188725265 CTCTCTGGTCACAGGTGGTATGG + Intronic
968900950 4:3431519-3431541 CTCTCTGACCGCGGGTGTCACGG + Intronic
969265177 4:6059728-6059750 CTCCCTGGCTCCATGTGACAAGG - Intronic
969387599 4:6865638-6865660 CTCTCTGGCCACAGGTGGCATGG - Intronic
974687317 4:65246767-65246789 CTCTCTGGGCAAAGATGTCATGG + Intergenic
975027893 4:69575476-69575498 CTCGCTGGCCTCAGGAGTGAAGG + Intergenic
975848056 4:78546237-78546259 CTCCCTGGCCACAGGTGTCACGG + Intergenic
984156406 4:176200442-176200464 CTTCTTGCCCACAGGTGTCTCGG + Intergenic
985502329 5:256575-256597 CTCCCTGGCCACTGGGTTCCTGG - Exonic
985636997 5:1040779-1040801 CTCCCGGGCCACACCTGTCGGGG + Intergenic
985734692 5:1572042-1572064 CTCCCTGGCCACTGGGTTCCTGG + Intergenic
986578796 5:9242277-9242299 CTTCATGGTCACACGTGTCAGGG + Intronic
994496164 5:100516761-100516783 CTCCATGGCCACTGGAGTCTCGG - Intergenic
995165118 5:109030776-109030798 CTCCCTTGCCAGAGATGACAGGG - Intronic
1001199765 5:169705439-169705461 CTGTCTGGCCCCAGGGGTCATGG - Intronic
1003021708 6:2515435-2515457 CACCCTGGGAACAGGTGTAATGG + Intergenic
1003532380 6:6948475-6948497 TTCTCTGGCCACAGGTCTCAGGG + Intergenic
1003934412 6:10960624-10960646 ATTCCTGACCACAGGTTTCAGGG + Intronic
1006377259 6:33678402-33678424 CACCCTGGACACAGGAGTCAGGG - Exonic
1006846936 6:37068921-37068943 CACCCTGGCCACAAGTGCCAGGG + Intergenic
1007460805 6:42017272-42017294 CTCCCAGGCCCCAAGTGCCAGGG - Intronic
1011078857 6:83467291-83467313 CTCCCTTTCCACTGATGTCAAGG + Intergenic
1011492873 6:87910613-87910635 ATCCATGGCCACAGTTGTCCTGG - Intergenic
1013011490 6:106124846-106124868 CTCCTTGGCCACATGTGTCCAGG - Intergenic
1014196492 6:118566035-118566057 CACCCTGGCCACAGTTATCCGGG + Exonic
1015036363 6:128659984-128660006 CTCCCTGGATAGAGGCGTCATGG + Intergenic
1016539298 6:145145532-145145554 ATCCATGGCCACAGCTGTGAAGG + Intergenic
1017693019 6:156986165-156986187 TTACCTGTCCTCAGGTGTCAAGG + Intronic
1018058553 6:160072143-160072165 CGCCCTGGGCAGAGGTGTCATGG + Intronic
1019518887 7:1451810-1451832 CTGCGTGGCCACAGGGGTCTCGG - Intronic
1019674883 7:2304962-2304984 CTCTCTGGCCAAAGCTGTCAAGG - Intronic
1020006070 7:4784358-4784380 CACCCTGGACACAGGTGTGCGGG + Exonic
1022418927 7:30202138-30202160 CTGCCTGGTCACATGTGGCATGG + Intergenic
1022573706 7:31477476-31477498 CTGCCTGGCCTCTGCTGTCAGGG + Intergenic
1023326849 7:39070044-39070066 CTCACTGGCCACACGTGCCCAGG + Intronic
1025023329 7:55496691-55496713 AACCCTGGGCACAGGTGTTAAGG + Intronic
1027179998 7:75931906-75931928 CTGCTGGGGCACAGGTGTCATGG + Intronic
1029278040 7:99419240-99419262 TTCCCTGTCCAGAGCTGTCAAGG + Exonic
1032474899 7:132204948-132204970 CTCCCTGGCAACGCGTGCCAGGG + Intronic
1032611937 7:133424297-133424319 CTCGCTGGCCTCAGGAGTGAAGG - Intronic
1033951207 7:146787523-146787545 CTCCCTGGCCTCAGGAGTGAAGG + Intronic
1036576126 8:10029304-10029326 CTCCCTGACAGCAGGTGTCTGGG - Intergenic
1037401438 8:18498750-18498772 GTCCCTGGGCACAGGGGACAGGG - Intergenic
1037930457 8:22877237-22877259 CTCCCTGTCCTCAGTTGTCCAGG + Intronic
1039156061 8:34558790-34558812 CGACCTGGGCACAGGAGTCAAGG + Intergenic
1040607363 8:48947054-48947076 CTGGTTGGCCACAGGTGTCAAGG + Intergenic
1044456997 8:92400743-92400765 CTCACTGGCCTCAGGAGTGAAGG + Intergenic
1045289647 8:100821483-100821505 CTCCCTGGCCACATGTCCCAGGG + Intergenic
1048046795 8:130780554-130780576 CTCCCTGGCCGCGGTTGTCCTGG - Exonic
1048050281 8:130809855-130809877 GTCCCTGGCCACAGCAGCCAGGG - Intronic
1048138127 8:131766064-131766086 GTCCCTGGCCACAGCTGCCAAGG - Intergenic
1048964257 8:139603993-139604015 CTCCCTGAGCTCATGTGTCAGGG + Intronic
1048985195 8:139731305-139731327 CTGCCTGGACATAGGTGTTATGG + Intronic
1050773172 9:9229369-9229391 CTTCCTGGCCACAGCTCACATGG - Intronic
1052735282 9:32335584-32335606 CTCCCTGCCCTCAAATGTCATGG + Intergenic
1057047489 9:91897593-91897615 CCACCTGGCCAAAGGTGTGAAGG + Intronic
1057204872 9:93165277-93165299 CCCCCTGGCCAGAGGGATCATGG - Intergenic
1057502859 9:95609675-95609697 CTCCTGGGCCACAAGTCTCATGG + Intergenic
1060407669 9:123380992-123381014 CTCCTCGGACACAGGTGACAGGG - Exonic
1060640003 9:125230408-125230430 TCCCCTGGCCTCAGCTGTCATGG - Intronic
1060732910 9:126049384-126049406 CTCCCTGGTCACAGATGTCCTGG - Intergenic
1060814593 9:126627935-126627957 TTCCCTGGGCCCAGGTCTCAGGG + Intronic
1062034870 9:134378557-134378579 CTCCTTGGGGACAGGTGACAGGG - Intronic
1062473193 9:136715103-136715125 CTCCCTGGCCGCAGGTGGACAGG + Intronic
1062546939 9:137068077-137068099 GCACCTGGCCACAGGAGTCAGGG + Intronic
1062653277 9:137589540-137589562 CTCAATGCCCACAGGTGCCATGG + Intronic
1185785445 X:2887012-2887034 ATGCCTGGCCCCAGGTGTGAGGG - Intergenic
1189297863 X:39931297-39931319 CTCCATGGCCACAGCTGTTGTGG - Intergenic
1189749896 X:44210097-44210119 CTCCATAGGCCCAGGTGTCATGG - Intronic
1198314383 X:135451694-135451716 CTCCTTGGACACAGATGTCCTGG + Intergenic
1199702447 X:150392534-150392556 TCCCCTGCCCAGAGGTGTCAGGG - Intronic
1200143347 X:153913043-153913065 CTCCCACCCCACAGGTGACAAGG - Exonic
1200217333 X:154373857-154373879 TTGCCTGGCCCCAGGTGGCACGG + Intronic
1201488813 Y:14519954-14519976 CTCCCAGGTCACATGTCTCAGGG + Intergenic