ID: 975850476

View in Genome Browser
Species Human (GRCh38)
Location 4:78566764-78566786
Sequence TCTTACATGCAGATGGTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 158}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975850476 Original CRISPR TCTTACATGCAGATGGTGCA TGG (reversed) Intronic
907925708 1:58953529-58953551 TCTTCCATGCACATGGTGCAAGG - Intergenic
909244167 1:73255934-73255956 TTTTACATGCAGAAGCTGAAAGG + Intergenic
909261623 1:73496603-73496625 TCTTACCTAGGGATGGTGCATGG - Intergenic
910438159 1:87226486-87226508 TTTTAAATGTAGATGATGCAAGG - Intergenic
910509744 1:87990568-87990590 CTTTACATGCTGATGGTGCAGGG + Intergenic
910820370 1:91338664-91338686 GCTAGCATGCACATGGTGCACGG + Intronic
911507892 1:98776215-98776237 TTTTATATACAGATGGTGCCTGG - Intergenic
912131776 1:106611869-106611891 TCTTATATGGACATGGTTCATGG + Intergenic
913110812 1:115655512-115655534 TCATACAGGCAGATGTTGCGTGG + Intronic
914831069 1:151171374-151171396 TCTTACATGCACCTGTTGCATGG - Intronic
919025971 1:192170928-192170950 TCTCAAATGCAGGTGGTGAAAGG + Intronic
919093908 1:193006725-193006747 TCTTACATGGGCATGGTTCATGG + Intergenic
919207620 1:194437506-194437528 TCTTGCATGCTGGTGGAGCAAGG - Intergenic
920311597 1:205052023-205052045 TCTTGCAGGCAGTTGGTGAAAGG + Intronic
923554822 1:234992307-234992329 TCATACCTGCAGATTCTGCAGGG - Intergenic
923579296 1:235192433-235192455 TCCTACATGCAAATAGTGCATGG - Intronic
1064638170 10:17389542-17389564 TCTTCCATGTAGATGAGGCATGG + Intronic
1064920586 10:20513098-20513120 TCTTACATTCATATATTGCACGG + Intergenic
1067547384 10:47203598-47203620 ACTTACATGCTGTTGGTGCAAGG - Intergenic
1068103316 10:52582640-52582662 TCTTACATGGAGACAGGGCAGGG + Intergenic
1070279460 10:75038072-75038094 TCTTACCTGCAGATGGAGCAGGG + Exonic
1070485672 10:76928683-76928705 TCCTACATACAGATGATGTAAGG + Intronic
1072559466 10:96557553-96557575 TCTTAAATGCAAAGGGGGCAGGG - Intronic
1073641220 10:105254575-105254597 TCTTACATGCAGGTTCTGCAGGG - Intronic
1073781054 10:106838926-106838948 TCTTACATGGGCATGGTTCAGGG - Intronic
1074619656 10:115106016-115106038 TTTTCCAGGCACATGGTGCAAGG - Intronic
1077700487 11:4436968-4436990 CTTTAAATGCAGATGGTGAAGGG + Intergenic
1078460403 11:11510963-11510985 TCTAACATGAGGATGGTGCCCGG + Intronic
1078713326 11:13816101-13816123 GCATAGATGCAGATGGGGCACGG + Intergenic
1079347450 11:19665364-19665386 GCTGAGAAGCAGATGGTGCATGG + Intronic
1079571326 11:21946766-21946788 TTTAACATGCAGATGATTCAAGG - Intergenic
1080900377 11:36484169-36484191 CCGTGCATGCTGATGGTGCAGGG + Intergenic
1081195040 11:40151011-40151033 TCTTGCAGGCATATGGAGCATGG - Intronic
1081381476 11:42421574-42421596 TCTTCCATGCTGATGTTTCAAGG - Intergenic
1085703204 11:78763480-78763502 GCTCACATGCTGCTGGTGCATGG + Intronic
1085921540 11:80963690-80963712 GTTGACCTGCAGATGGTGCAAGG - Intergenic
1086766268 11:90699222-90699244 TATTACATGTAGAAGCTGCAGGG - Intergenic
1087849816 11:103015438-103015460 TCTTGCATGCATATATTGCATGG + Intergenic
1088119208 11:106348210-106348232 TCTTACATACAGATTGTATAAGG - Intergenic
1088688375 11:112304252-112304274 TGTTACAGGCATATGGGGCAGGG + Intergenic
1090433017 11:126662526-126662548 CCTTATATGCAGAAGGTGGAAGG + Intronic
1092067198 12:5600802-5600824 TCCTACATCCAGATGAAGCATGG - Intronic
1099336698 12:81369437-81369459 TGTAACATGCAGACTGTGCATGG + Intronic
1100400085 12:94221778-94221800 TCTCACATACAGAAGGGGCAGGG + Intronic
1100971997 12:100080222-100080244 TTTTCCAGGCACATGGTGCAAGG - Intronic
1101732130 12:107435543-107435565 TGTCTCATGCAGTTGGTGCAGGG + Intronic
1102150470 12:110686371-110686393 AGTTACATGCTGAGGGTGCAAGG + Intronic
1104534068 12:129601742-129601764 TCTTACATGGGCATGGTTCATGG + Intronic
1106117424 13:26829642-26829664 TCCTGCAGGCAGATGGTGGAGGG + Intergenic
1107957441 13:45529804-45529826 TCTTATATGCAGTTGCCGCAAGG - Exonic
1108707254 13:53000860-53000882 TCTGGCCTGCAGATGGAGCAAGG + Intergenic
1110306310 13:73991348-73991370 TCTAACATGCACTTGGTGCATGG - Intronic
1111358204 13:87139066-87139088 TCCTACATGCAGATGATTAAAGG - Intergenic
1112826552 13:103398515-103398537 TTTTCCAGGCACATGGTGCAAGG + Intergenic
1113554956 13:111225710-111225732 TCTTACATGGGCATGGTTCATGG - Intronic
1115803036 14:37017404-37017426 TTTTACATGTACATGGTTCATGG + Intronic
1115954440 14:38762437-38762459 CCTTTCTTGCAGATGGTGCATGG - Intergenic
1123138960 14:106056458-106056480 TCTTACCTGGAGTTGGTTCAGGG - Intergenic
1130129840 15:81130918-81130940 TCTTATATGCCCATGGTTCATGG + Intronic
1130259940 15:82346821-82346843 TCTTACCTCCAGATCCTGCAGGG + Exonic
1130268785 15:82432615-82432637 TCTTACCTCCAGATCCTGCAGGG - Exonic
1131400943 15:92125230-92125252 TCTACCATGTAGATGATGCATGG - Intronic
1132478273 16:153333-153355 TCTGACAAGCAGAGGGTGAAAGG + Intronic
1132480358 16:163923-163945 TCTGACAAGCAGAGGGTGAAAGG + Intronic
1133329142 16:4960571-4960593 TGTTACAGGCAGATGGTTCTAGG + Intronic
1137527573 16:49249771-49249793 TCTTACTTGCAGATTCTGGAAGG - Intergenic
1143652998 17:8275856-8275878 TCTTACATACAGCAGGTGCTGGG - Intergenic
1144642066 17:16943104-16943126 TCTGTCATGCAGATGGTGCTGGG - Intronic
1152449480 17:80367974-80367996 TCTCCCAGGCAGATGGAGCACGG - Exonic
1159761991 18:72438534-72438556 TGTTACATGCATATATTGCATGG + Intergenic
1162222753 19:9192127-9192149 TCTGCCATGCAGCTGCTGCAGGG - Intergenic
1163503498 19:17689556-17689578 TCATAAATGCAGAATGTGCATGG + Intergenic
1166641327 19:44497611-44497633 GCTTACAGGTAGATGGTCCAGGG - Intronic
1167684931 19:50950214-50950236 TCTGACATGCTGAGGGGGCAGGG + Intronic
1167719115 19:51166597-51166619 TTTTACGTGAAGATGCTGCATGG + Intergenic
1167772998 19:51532448-51532470 ATTTACATGAAGATGTTGCATGG - Intergenic
927319365 2:21724530-21724552 TCTGAGATCCAGATGGTTCAAGG + Intergenic
932662066 2:73663745-73663767 TCATACATACAGAGGGTGAAAGG - Intergenic
932857398 2:75250688-75250710 TCTTACATTAACATGGTTCATGG + Intergenic
938329795 2:130441536-130441558 TCTGAGATGCAGGTGGTGCCAGG + Intergenic
938360151 2:130679967-130679989 TCTGAGATGCAGGTGGTGCCAGG - Intergenic
938436554 2:131286674-131286696 TCTGAGATGCAGGTGGTGCCAGG - Intronic
940068017 2:149651501-149651523 TCTTGCATGCAGATGATCAAAGG + Intergenic
944088648 2:195878834-195878856 TCTTACCAGAAGATGGTGAAAGG + Intronic
944848873 2:203696595-203696617 TCTTACATGCATATATTGCATGG + Intergenic
944923968 2:204443984-204444006 TGCTACATGCAAATGGGGCAAGG - Intergenic
946794306 2:223333130-223333152 TATTACATCCACTTGGTGCAGGG - Intergenic
1171112769 20:22499745-22499767 TTCTACAGGCAGATGGTGCTGGG + Intergenic
1172381198 20:34493903-34493925 CCCTACATGCAGATGGTTCTAGG - Intronic
1173030854 20:39358320-39358342 TCTTACATGCAGAAGGGCCTGGG + Intergenic
1174652551 20:52140062-52140084 TCTTATATGGACATGGTTCATGG - Intronic
1175007285 20:55698520-55698542 TCTTAGATTCAGAGGGTACATGG + Intergenic
1175371690 20:58496754-58496776 TGTTACAGGCAGAAGCTGCAAGG + Intronic
1176139590 20:63539142-63539164 TCTCCCATGCAGATGGAGCTGGG + Intergenic
1177044030 21:16146931-16146953 TCTTACATGCAGGAGGTTCATGG - Intergenic
1177467462 21:21506119-21506141 TCTCACATGCAGATAGTTCTAGG - Intronic
1179031002 21:37719263-37719285 GCATGCATGCAGATGTTGCAGGG + Intronic
1179085011 21:38208163-38208185 GTTAACATGCAGATTGTGCAGGG + Intronic
1179936723 21:44610705-44610727 TTTTCCAGGCACATGGTGCAAGG - Intronic
950375508 3:12568945-12568967 TAGTACTTGCAGATGGTGGACGG - Exonic
950873911 3:16253046-16253068 TCTTCCATGGAGGTGGTGGAGGG - Intergenic
951131002 3:19044952-19044974 TCTCACCTGGAGATCGTGCATGG + Intergenic
952271211 3:31833458-31833480 CCTGACATGCAGAAGCTGCATGG + Intronic
952733619 3:36665954-36665976 TCTTACATATAGAGAGTGCATGG - Intergenic
954646222 3:52133203-52133225 CCTCACATGCAGAAGGTGGAAGG - Intronic
956171591 3:66437693-66437715 TGCTACATGCAGCTGCTGCAAGG + Intronic
956406827 3:68936640-68936662 TCTTACGTGGACATGTTGCATGG - Intergenic
959031241 3:101301150-101301172 TCTTACATGGATATTGTTCATGG + Intronic
961110022 3:124276026-124276048 TCTCAGATGTAGAGGGTGCATGG - Intronic
961724001 3:128913979-128914001 TCTTACATGCCAATGGAGAATGG + Intronic
962430733 3:135317136-135317158 TCTTAGTAGTAGATGGTGCAAGG + Intergenic
963190028 3:142459709-142459731 TCATACATGCAGGTTCTGCAGGG + Intronic
964098434 3:152961176-152961198 TCTTACCTGCAGAATGTACAGGG - Intergenic
966899392 3:184469440-184469462 TCTGACATGCAGAGGGTCCGGGG + Intronic
968947000 4:3670414-3670436 TCTCACAGGCTGATGGTGCCTGG - Intergenic
970744764 4:19281469-19281491 TTTTACAGGCACAGGGTGCAAGG + Intergenic
972439032 4:39067014-39067036 TCTCACATTAATATGGTGCATGG + Intronic
972701585 4:41499326-41499348 TCTTACATTCAAATGGTTCAGGG - Intronic
973327548 4:48878632-48878654 TGTGCCATGCAGATGGTTCAGGG + Intergenic
975850476 4:78566764-78566786 TCTTACATGCAGATGGTGCATGG - Intronic
979619323 4:122780803-122780825 TCTTATATGGACATGGTTCATGG + Intergenic
986113887 5:4750381-4750403 TTTTCCAAGCACATGGTGCAAGG + Intergenic
986486260 5:8241521-8241543 TGTTCCATGCATATGTTGCATGG - Intergenic
986718475 5:10540933-10540955 TTTAAAATGCAGATGGTACAGGG + Intergenic
991171618 5:63633144-63633166 TCTTACATGGATATGGTTCATGG + Intergenic
991996662 5:72394487-72394509 TCTTAACTCCAGATGGTCCAAGG + Intergenic
992510420 5:77427490-77427512 TATTACGTATAGATGGTGCATGG - Exonic
994996740 5:107073262-107073284 TTTTACCTGCAGAGAGTGCAAGG - Intergenic
995741614 5:115361723-115361745 TCTTATATGGTGATGGTTCATGG + Intergenic
995783411 5:115802247-115802269 TCTTACCTGCAGCTGGAGCTTGG - Intergenic
996147758 5:119996389-119996411 CCTTACTTGAAGATGCTGCAAGG - Intergenic
996779536 5:127170943-127170965 TCCAACATGCAGTTGTTGCAGGG - Intergenic
999019506 5:148148049-148148071 TCTTATATGAAGATGTTGAAGGG - Intergenic
999250109 5:150177417-150177439 TCTAGCATGCAGGAGGTGCATGG - Intronic
1000132813 5:158316235-158316257 TCTTACATGGAGATGTTGGTTGG + Intergenic
1001870644 5:175151329-175151351 TCTGACATGCAGCTGGTCAATGG + Intergenic
1002383749 5:178850277-178850299 CCTTACATACAGATTGAGCAGGG - Intergenic
1003461441 6:6332448-6332470 TCTTGCATGCGGTTTGTGCAGGG - Intergenic
1003469924 6:6420103-6420125 AGTTACCTGCAGATGGTGGAAGG + Intergenic
1007257959 6:40541741-40541763 TCTCACTTGCAGAAGATGCAGGG + Intronic
1007570708 6:42888601-42888623 TCTGAGTTACAGATGGTGCAGGG - Exonic
1007820350 6:44556165-44556187 TCCTAGAGGCAGAAGGTGCAAGG + Intergenic
1008382133 6:50848004-50848026 TCTAAGAAGGAGATGGTGCACGG + Intergenic
1020052226 7:5089247-5089269 TCTTGCATGCAGTTGGTGGAAGG - Intergenic
1022907557 7:34871568-34871590 TTTTACAGGCTGATGGTGGAAGG - Intronic
1023276081 7:38519966-38519988 TCTTAGATTCAGAGGGTTCATGG - Intronic
1029695927 7:102213202-102213224 TGTCCCTTGCAGATGGTGCAGGG + Intronic
1031290226 7:119924908-119924930 TGTTACATCCATATGATGCATGG - Intergenic
1034507414 7:151504428-151504450 TCATATATGCAGATTCTGCAGGG - Intronic
1034999208 7:155598167-155598189 TCTTAGATGCAAATTTTGCATGG - Intergenic
1035107300 7:156452555-156452577 ACTTACATTCAGGTGGGGCAGGG + Intergenic
1035889977 8:3332758-3332780 TCTGACGGGCAGATGTTGCAGGG + Intronic
1036706769 8:11052483-11052505 TCTGGCATGCAGATGGCGCGAGG + Intronic
1037255996 8:16954379-16954401 TCTTACATGCACATATTGCCTGG - Intergenic
1037927762 8:22857922-22857944 ACTTACATGCCCCTGGTGCATGG + Intronic
1039570811 8:38585136-38585158 TCTTACATGCAGACGTTGGGTGG + Intergenic
1041206688 8:55506539-55506561 TCTTAAACAAAGATGGTGCAAGG - Intronic
1043153603 8:76749185-76749207 TATCACATACAGATGGTGGAAGG - Intronic
1046648690 8:116813341-116813363 TGTCACATGCTGATGCTGCAGGG + Intronic
1047644914 8:126860269-126860291 GCTTACCTGAAGCTGGTGCATGG - Intergenic
1048951751 8:139502237-139502259 GCAGACATGCAGATGGTGTAGGG - Intergenic
1050941701 9:11468850-11468872 TCTTAAATGCAGGTTGTTCATGG + Intergenic
1051085039 9:13338517-13338539 TCTTACATGGGCATGGTTCATGG + Intergenic
1055411765 9:76037972-76037994 AATTACATGCAGCTGGTGCGTGG - Intronic
1055977844 9:81971987-81972009 ACTTGCATGCAGATGGGGCTTGG - Intergenic
1057847697 9:98538321-98538343 TCTTTCATCCAGAGGGGGCATGG + Intronic
1058576970 9:106414211-106414233 TTTTTCATGCAGATGATGCACGG - Intergenic
1059864813 9:118502502-118502524 TGTTACATGCATATATTGCATGG + Intergenic
1060212355 9:121718291-121718313 GCGTTCAGGCAGATGGTGCAAGG + Intronic
1060558671 9:124524603-124524625 TCTTTCATGCAGTTGGTGATGGG + Intronic
1061172746 9:128970320-128970342 TCATTCATGGAGATGGTACAAGG + Intronic
1187855447 X:23632455-23632477 TCTTACATGCATATATTGCATGG + Intergenic
1188924869 X:36027230-36027252 TCTTACATGCATATGTTGCATGG + Intergenic
1189550635 X:42088897-42088919 TCTTGCATCCAGACGCTGCATGG - Intergenic
1192591619 X:72364769-72364791 TCTTATATGCATATATTGCATGG - Intronic
1193113068 X:77749002-77749024 TCGTACATGCATATATTGCATGG + Intronic
1193237948 X:79131650-79131672 TTTTAGAGGCAGAGGGTGCAAGG - Intergenic