ID: 975854451

View in Genome Browser
Species Human (GRCh38)
Location 4:78608409-78608431
Sequence CAGATCATGCAGGACCTTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 625
Summary {0: 1, 1: 1, 2: 24, 3: 118, 4: 481}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975854443_975854451 21 Left 975854443 4:78608365-78608387 CCTCATGGTGGAGGAAGCATAAT 0: 1
1: 0
2: 1
3: 16
4: 210
Right 975854451 4:78608409-78608431 CAGATCATGCAGGACCTTTTTGG 0: 1
1: 1
2: 24
3: 118
4: 481

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975854451 Original CRISPR CAGATCATGCAGGACCTTTT TGG Intronic
900828559 1:4947176-4947198 CAAATCTTGCAGGAGCTTCTTGG + Intergenic
902408565 1:16199760-16199782 CAGACCATGAAGGGCCTTGTAGG - Intronic
903087286 1:20873138-20873160 CAAATCATGTAGTATCTTTTTGG + Intronic
903320572 1:22540727-22540749 CAGAGTATGCAGGGCCTTCTAGG + Intergenic
903352056 1:22723281-22723303 CAGAGCCCGCAGGGCCTTTTTGG + Intronic
903690688 1:25171348-25171370 CGGACCATGCAGGATCTTGTAGG - Intergenic
904053485 1:27655362-27655384 TAGATCACGCAGGGCCTTGTAGG + Intergenic
904730430 1:32586788-32586810 CAGATCATATAGGGCCTTTTAGG + Intronic
905280624 1:36846755-36846777 CAGACCATGCAGAGCCTTTTGGG + Intronic
905654396 1:39676783-39676805 CCGATCATGCAGGACCTGGAGGG + Intergenic
905843310 1:41204438-41204460 CAGATCATGCAGGACTATGTGGG - Intronic
906096556 1:43228147-43228169 TGGATCACGCAGGACCTTGTGGG - Intronic
906399559 1:45495051-45495073 CAGGTCATTCAGGAGCATTTTGG + Intronic
906824068 1:48959864-48959886 CAGATCATGTAGGGCCTTGTAGG + Intronic
907021249 1:51068599-51068621 CAGATCATGAAGGGTCTTGTGGG - Intergenic
907123075 1:52024688-52024710 TAGATCATGTAGGGCCTTATAGG - Intronic
907530221 1:55088037-55088059 CAGATCAAGCAAGGCCTTGTGGG + Intronic
907924764 1:58944832-58944854 TAGATCATCCAGGACCTTATGGG + Intergenic
907952162 1:59194151-59194173 CAGAGCATGCATGACCTTGTTGG - Intergenic
908508139 1:64826586-64826608 CAGACAATTTAGGACCTTTTAGG + Intronic
908724330 1:67158502-67158524 CAGATTATGCAGAAATTTTTAGG + Intronic
910206441 1:84753226-84753248 CGGATCATGCAGAAACCTTTAGG - Intergenic
910662560 1:89689340-89689362 CAGATCACGTAGGGCCTTCTAGG + Intronic
911560152 1:99395152-99395174 CAGACACTGCATGACCTTTTTGG - Intergenic
911994086 1:104740724-104740746 CAGATCTAGCAGCAGCTTTTTGG + Intergenic
912698478 1:111858748-111858770 CAGATCATGGAAGGCCTTGTAGG - Intronic
913286902 1:117234880-117234902 TAGATCATGTAGGGCCTTGTGGG + Intergenic
914254394 1:145949539-145949561 CAGACCAAGTAGGGCCTTTTAGG + Intronic
914355246 1:146879203-146879225 CAGGTCTTGCAAGGCCTTTTAGG - Intergenic
915072913 1:153287162-153287184 TGGATCATGTAGGACCTTTTAGG + Intergenic
915113312 1:153578647-153578669 CAAATCATGCAGAGCCTTGTAGG + Intergenic
915900337 1:159842119-159842141 CAGATCATGCAGGGTCTGATAGG + Intronic
915923991 1:160002365-160002387 CAGATCCTGCAGGGTCTTGTAGG - Intergenic
917427280 1:174928058-174928080 CAGATCTTGAAGGGCCTTATAGG - Intronic
917948722 1:180005687-180005709 TAGATCATGCAGGGCCATCTAGG - Intronic
918316179 1:183324500-183324522 CAAACCATGCAGGGCCTTCTGGG - Intronic
918327211 1:183421320-183421342 CAGATCATACAGGGCCTTGTAGG + Intergenic
918413264 1:184282470-184282492 CAGATCCTGCAGGGCCTTTCAGG + Intergenic
918420661 1:184361351-184361373 CAGATTATGCAGAAAGTTTTAGG + Intergenic
918575796 1:186058095-186058117 CACCTCATGCTGGAGCTTTTGGG + Intronic
918641755 1:186849495-186849517 CAGATCATGTTGAACCTCTTAGG - Intronic
919300872 1:195763659-195763681 AAAATGATGCAGGACTTTTTGGG - Intergenic
919733753 1:200931316-200931338 CAGATCATGAAGGGTCTTGTGGG - Intergenic
919947426 1:202329851-202329873 CAGATCATGCGGGGTCTTATGGG + Intergenic
920036172 1:203067280-203067302 CAGATCATGGAGTATCTTATAGG + Intronic
921813807 1:219544466-219544488 CAGACCATAAAGGACCTTGTAGG + Intergenic
922224082 1:223630198-223630220 CAGATCATGAATGACTTTGTTGG - Intronic
922248673 1:223826231-223826253 CAGATCATGCATGTCTTTATAGG + Intronic
922429080 1:225529220-225529242 CAGATCATGCAGGACCTTGCAGG - Intronic
922518978 1:226229875-226229897 CAGATCATGCATGGCTTTATAGG + Intergenic
922655450 1:227378527-227378549 AAGATCATGCAGCACTTTATAGG + Intergenic
923403237 1:233636139-233636161 CAGATCATGTAGGACCTTATGGG + Intronic
923543624 1:234908099-234908121 CAAATAATGCAGGATCTTTATGG + Intergenic
923884608 1:238140651-238140673 CAGATAATGAAGGGCCTTATAGG + Intergenic
924200193 1:241650500-241650522 CAGATCACGTAGGATCTTATTGG - Intronic
924721502 1:246627274-246627296 AAGATCATGTAGGGCCTTGTAGG - Intronic
1065388918 10:25162134-25162156 CAAATCATGTAGGACTTTATGGG - Intergenic
1066637021 10:37513837-37513859 CAGATCTGGCAGGACCATTTTGG - Intergenic
1067300109 10:45000598-45000620 CCCATCTTGCAGGAGCTTTTTGG + Exonic
1067796683 10:49326363-49326385 CGGATCCTGGAGGACCTTCTGGG - Exonic
1068143867 10:53040661-53040683 CACATCATGCAGGACCACATGGG + Intergenic
1069173363 10:65260485-65260507 CAGATCAGGCAGGGCCTTACAGG + Intergenic
1069400140 10:68035639-68035661 TAGATCATACAGCACCTTATAGG - Intronic
1069927440 10:71860558-71860580 CAGCTCATGCAAGGCCTTCTTGG - Intergenic
1070112900 10:73501675-73501697 CATATCACACAGGACCTTGTAGG - Intronic
1070183770 10:74039875-74039897 CAGATCATAAAGAGCCTTTTAGG - Intronic
1071986950 10:91061535-91061557 CAGATCATGGGGGACCTTGTAGG - Intergenic
1072690075 10:97566976-97566998 CAGATGCTGCAGGAATTTTTGGG + Intronic
1074275602 10:111999193-111999215 CAGACCATGCAGGACCACATGGG + Intergenic
1074918554 10:117983181-117983203 CAGATCATGCAGGGCTCTCTAGG - Intergenic
1075190861 10:120307184-120307206 CAGACTCTGCAGGACCTTTCGGG - Intergenic
1075203066 10:120422420-120422442 CGGATCATGCAGGCCATGTTGGG + Intergenic
1075462524 10:122627018-122627040 CAGATCATTCAGGGCCTTGTGGG + Intronic
1075575827 10:123576804-123576826 TAGCTCATGCATCACCTTTTAGG - Intergenic
1075972422 10:126665949-126665971 CACATCATTCAGGAGCTATTTGG + Intronic
1076297459 10:129397664-129397686 CGGATCCTGCAGGACTTTGTGGG - Intergenic
1077704475 11:4471379-4471401 CAGATCACACAGGACCTCATAGG - Intergenic
1077900825 11:6486984-6487006 TGGATCATGCAGGGCCTTGTAGG - Intronic
1078731549 11:13979588-13979610 CAGATCCTGCGGGGCCATTTTGG + Intronic
1079619970 11:22542025-22542047 CAGATCATGCAATGCCTTGTGGG + Intergenic
1080504654 11:32900590-32900612 TAGATCATGCAGGGCTTTGTAGG - Intronic
1080580369 11:33637445-33637467 CAGATCATGCAGGGTCTTAAAGG - Intronic
1080582142 11:33652408-33652430 GAGATCAGGCAGACCCTTTTGGG - Intronic
1080760537 11:35244820-35244842 TAGATAATGCAGGACCCTATGGG + Intergenic
1080935856 11:36862672-36862694 CAGATCATATAGGATCTTTTGGG - Intergenic
1081470811 11:43368800-43368822 TAGATCTTACAGGACCTTGTAGG - Intronic
1081700463 11:45149306-45149328 CAGATCATTCGGTAGCTTTTAGG - Intronic
1081729768 11:45362222-45362244 TAGATCATGTAGGGTCTTTTGGG - Intergenic
1081925050 11:46819387-46819409 CAGATCATGCAGGACTATGAAGG + Intronic
1082773124 11:57224242-57224264 CAGGTCATGTAGGACCTTGAAGG - Intergenic
1082812671 11:57487993-57488015 CAGAGCTTGCAGGGCTTTTTAGG + Intronic
1082839139 11:57674461-57674483 CAGAGCATGCTGGATCTTCTGGG + Intronic
1084977538 11:72810860-72810882 CAGATCAAGCAGGGCCTTGAAGG + Intergenic
1085063697 11:73472456-73472478 CAAATCATGCAGGGCCTCATAGG + Intronic
1085358017 11:75857266-75857288 CAGATCATGAAAGGCCTTCTAGG - Intronic
1086231250 11:84572624-84572646 AAGAACATGCAGAATCTTTTAGG - Intronic
1086884772 11:92192634-92192656 CAGATCATAAAGGATCTTTTAGG - Intergenic
1086885481 11:92200629-92200651 CAGATCATGCAGGACTGTTTGGG + Intergenic
1087017846 11:93571930-93571952 CACATCAGGCAGGACCTTAAAGG + Intergenic
1087996332 11:104813764-104813786 CAGTTCATGTAGGGACTTTTAGG + Intergenic
1088280055 11:108126432-108126454 CAGATCATGCAGGTTCTTGGAGG + Intronic
1088673685 11:112168971-112168993 CAGATAATACAGGACCTTGAAGG + Intronic
1090772631 11:129934650-129934672 CAGATCAGGTAGGGCCTTATGGG - Intronic
1091156387 11:133377924-133377946 CAGTTCCTGCAGGACCTTCAGGG + Intronic
1091182869 11:133622601-133622623 CAGATTATGAAGGACTTTATAGG - Intergenic
1091427790 12:406502-406524 CAGATCATACAGGACCTTGTCGG + Intronic
1091985417 12:4907318-4907340 CAGATCATGCAGGGCCTCTAAGG - Intergenic
1092052045 12:5478614-5478636 CAGGTCTTGAAGGAACTTTTTGG + Intronic
1092088838 12:5787351-5787373 CAGGTCACGGAGGAGCTTTTGGG - Intronic
1092381813 12:8002779-8002801 CAGAGCATACATGACCTTCTGGG - Intergenic
1092391985 12:8088720-8088742 CAGATCACGCAGGGCCTTGTGGG - Intronic
1092737353 12:11595093-11595115 CCGATCATGCAGGACATTGTAGG - Intergenic
1092774535 12:11930957-11930979 CAGATCCAGCAGGACCTTAGGGG - Intergenic
1093393383 12:18651052-18651074 CAGATCACATAGGGCCTTTTAGG - Intergenic
1093422370 12:18988944-18988966 CAAATCAGGCAGAACCCTTTCGG + Intergenic
1093547405 12:20365379-20365401 AAGATCATGAAGGTCCTTGTAGG + Intergenic
1094055506 12:26265432-26265454 TAGATCATGAAGGACCTTGCAGG + Intronic
1095282177 12:40366092-40366114 CAGCTCATGCAGCACCTTGTAGG - Intronic
1095700504 12:45186220-45186242 CAGATCATGTAGGGCCTTACAGG + Intergenic
1095730446 12:45500971-45500993 CAGATCATTTAGGAACTTCTAGG + Intergenic
1096176222 12:49521279-49521301 AAGATCATCCAGGACCTTACAGG + Intronic
1096201734 12:49688410-49688432 CAGATTATGTGGGACCTTGTTGG - Intronic
1096684068 12:53276389-53276411 CAGATCACACAGGGCCTTATAGG + Intronic
1096971964 12:55673925-55673947 CAGATCACACAGGGCCTTATGGG + Intergenic
1097159035 12:57032753-57032775 CAGATCATGATGGGCCTTGTAGG + Intronic
1097377894 12:58860424-58860446 CAGATCATTCTGGAGCTTTAAGG - Intergenic
1097574744 12:61377438-61377460 AAGATCTTGCAGGGCCTTTTCGG + Intergenic
1097682111 12:62658572-62658594 CAAATCATGTAGGATCTTTAGGG + Intronic
1097833434 12:64249883-64249905 CATATCATGCAGGACCTAAGTGG - Intergenic
1097962317 12:65544862-65544884 CAGATCATGAAGGGACTTCTAGG - Intergenic
1098216946 12:68230725-68230747 AAGATCATGCAGAGCCTTTTAGG + Intergenic
1098641938 12:72849525-72849547 CAGATAATACAGGACCTTGTAGG + Intergenic
1099210901 12:79787267-79787289 CAGATCATGCAGTGCCTTATAGG - Intronic
1099372647 12:81856320-81856342 CTGATCATACAGGAACTTGTAGG + Intergenic
1099496889 12:83359310-83359332 CAGATCATGTAGGATGTTGTAGG + Intergenic
1100016070 12:90012263-90012285 TAAATCATCCAGGACCTTGTTGG - Intergenic
1100113268 12:91271526-91271548 TAGACCATGCATGACCTTTTGGG + Intergenic
1100661290 12:96701804-96701826 CAGATCATGTAAGACCTCATAGG + Intronic
1101055132 12:100904666-100904688 TAGATCGGGCAGGACCTTATAGG + Intronic
1101451762 12:104786174-104786196 GAGATTATGAAGGACCTTGTTGG + Intergenic
1101931747 12:109020603-109020625 CAGATCTGTCAGGACCTTATGGG - Intronic
1102353283 12:112211022-112211044 CAGATCCTATAGGACCTTATAGG + Intronic
1102478489 12:113204275-113204297 CAGATCACACAGGGCCTTTGAGG - Intronic
1103143380 12:118571900-118571922 CAGATCATTCTGGGCCTTCTAGG - Intergenic
1103172597 12:118834282-118834304 CAGATCATGCAGGGACATGTTGG + Intergenic
1103252086 12:119508681-119508703 CAGAGCACGCAGGGCCTTTGTGG + Intronic
1103813545 12:123634818-123634840 CAGGTCATGCAGGGCCTTATTGG + Intronic
1104072345 12:125356703-125356725 CAGACCACGCAGGGCCTTGTAGG - Intronic
1104657160 12:130581900-130581922 CAGGTCATGCAGAGCCTTTCGGG - Intronic
1104697903 12:130878500-130878522 CAGAGCCTGCAAGACCTTGTAGG - Intergenic
1106310082 13:28546444-28546466 TAGATCATGCAGAACCTTGTAGG + Intergenic
1106446374 13:29835923-29835945 TAGATCATGCAGGACCCTGAAGG + Intronic
1107821029 13:44285843-44285865 CAGTTCATGCAGGACCTGAGGGG - Intergenic
1108161549 13:47645463-47645485 CAGATCATGCAGGGCCCTGTAGG - Intergenic
1108994973 13:56718723-56718745 CAGATCATATATGACCTTGTAGG + Intergenic
1109278321 13:60326431-60326453 CAGATCATTTAGGGCCTTATAGG + Intergenic
1110064765 13:71089386-71089408 CAGATCATGTAGAACCTGGTGGG + Intergenic
1110142264 13:72144978-72145000 CAGCTCCTGCAGGATCATTTTGG - Intergenic
1110270503 13:73584306-73584328 CATATTATGCAGGATCTTGTAGG + Intergenic
1110559472 13:76895066-76895088 CAGCTCATTCATGATCTTTTTGG + Intergenic
1110610666 13:77484109-77484131 CAGATGATCTAGGAGCTTTTGGG + Intergenic
1110639217 13:77802530-77802552 AAGATCATGTAGGAGCTTGTAGG + Intergenic
1111147606 13:84204995-84205017 CAAATAATGTAGGAACTTTTGGG + Intergenic
1111698974 13:91661843-91661865 CAGATCATTCAGGGCCCTGTGGG + Intronic
1113510347 13:110849414-110849436 CAGATCATGGTGGGCATTTTGGG + Intergenic
1114388169 14:22277583-22277605 CAAACCATGGAGGAGCTTTTAGG + Intergenic
1115732666 14:36287994-36288016 CAGATCATGTAGGGCCCTGTAGG + Intergenic
1115775164 14:36706993-36707015 CAGATCATACTGGCCCTTGTAGG - Intronic
1117025264 14:51613084-51613106 CAGTTTATGGAGGACCTTTTTGG + Intronic
1117169424 14:53077403-53077425 CAGTTCATGCAGAAACTATTTGG - Intronic
1117803624 14:59468288-59468310 CAAATCATGCAGTGCCTTGTAGG - Intronic
1117828730 14:59729288-59729310 CAGATCATGTAGGATCTCATGGG + Intronic
1117861447 14:60096341-60096363 GCTATCATTCAGGACCTTTTGGG + Intronic
1118221238 14:63856195-63856217 CAGATCATGCAGGGCCTTTCTGG + Intronic
1118235950 14:64005120-64005142 TAGCTCATGCAGGAACTTTTAGG + Intronic
1118636718 14:67754780-67754802 CAGAACGTGCAGGAGCCTTTTGG + Intronic
1119557558 14:75565421-75565443 CAAATCTTGCAGGGCCTTGTGGG - Intergenic
1119715473 14:76856069-76856091 CACATCATGGAGAACCTTATAGG - Intronic
1119900624 14:78256547-78256569 CACATCATGCACCCCCTTTTAGG + Intronic
1120000427 14:79296890-79296912 CAGATCACGCAGGAACTGCTAGG - Intronic
1120013670 14:79445814-79445836 CAGATCATGGAGGGCCTTTGGGG + Intronic
1120316620 14:82902496-82902518 CAGATCATGCAGTACACTGTAGG - Intergenic
1120828346 14:88975239-88975261 CTGATCATGCCAGGCCTTTTTGG - Intergenic
1122286466 14:100655379-100655401 CAGAACATGCAGGGCCTCCTTGG - Intergenic
1124321986 15:28720799-28720821 CAGACCATGCAGCACCTCTCTGG + Intronic
1124523086 15:30422641-30422663 CAGACCATGCAGCACCTCTCTGG + Intergenic
1124535580 15:30543575-30543597 CAGACCATGCAGCACCTCTCTGG - Intergenic
1124763074 15:32464021-32464043 CAGACCATGCAGCACCTCTCTGG + Intergenic
1124775553 15:32585038-32585060 CAGACCATGCAGCACCTCTCTGG - Intergenic
1125102745 15:35933822-35933844 CAGATCATCCAGGGCCTTGTTGG + Intergenic
1125306356 15:38320392-38320414 CAGCTCATGCAGGGCCTAGTAGG + Intronic
1125522039 15:40353699-40353721 CAGAACATGCAGGACCACTCAGG + Intronic
1125841612 15:42806502-42806524 CAGATAATGCAGGGCCTTGTAGG - Intronic
1125900629 15:43343337-43343359 CAGATCATGTGGGACCTTGTAGG - Intronic
1126033544 15:44524205-44524227 GAGAGAATGCAGGACCCTTTTGG + Exonic
1127222548 15:56895478-56895500 ATGATCATGAAGGATCTTTTGGG + Intronic
1127345054 15:58086447-58086469 CATATCATGCATGACCTTGGTGG + Intronic
1128194895 15:65743872-65743894 CAGATCATGTGGGTCCTTTTAGG + Intronic
1128581049 15:68810175-68810197 CAGACCATGCAGCACCTTGTTGG + Intronic
1129624534 15:77182792-77182814 CAGATCATGCAAGGCCTTTTAGG + Intronic
1129992683 15:79978429-79978451 CAGAGCATGGAGAGCCTTTTAGG - Intergenic
1130064048 15:80590262-80590284 CAAATCATTCAGTACCATTTTGG - Intronic
1130318449 15:82817360-82817382 CAGACCATGCAGGGGCTTGTGGG + Intronic
1131623843 15:94097060-94097082 CAGAACATTCAGGGCCTTGTAGG + Intergenic
1134135731 16:11675174-11675196 CAGAACAGGCAGGTCCTTTGGGG - Intronic
1134306582 16:13038382-13038404 TAGATTGTGCAGGACCTTGTGGG - Intronic
1134331138 16:13252125-13252147 CAGATCATGGAAGGTCTTTTGGG - Intergenic
1134662100 16:15991921-15991943 CAGTTCATGCATGCCCTGTTAGG + Intronic
1134819910 16:17238627-17238649 CTGGTCATGCAGGACCTTGTAGG - Intronic
1134857503 16:17532606-17532628 CAGAACATGCATGAGCCTTTAGG + Intergenic
1136056730 16:27695311-27695333 CAGGTCATGCAGGGCCTTGCAGG - Intronic
1136596421 16:31253254-31253276 CAGGTCATGCAGGTCCTTGTAGG + Intergenic
1137343625 16:47634818-47634840 TAGATCATGGAGGGCCTCTTGGG + Intronic
1137634989 16:49978315-49978337 CAGATCATGGGGAACCTTCTAGG - Intergenic
1137989207 16:53135240-53135262 CAGATTATACAGGGCCTTGTGGG + Intronic
1138044357 16:53705312-53705334 CAGATCATGCAGGATCTTGTAGG - Intronic
1138356336 16:56383970-56383992 CAGAACATGCAGGGTCTTATAGG - Intronic
1138369742 16:56517290-56517312 CAGATCATATAGGAACTTGTAGG - Intronic
1139607908 16:68033012-68033034 CTGATCATGCAGGGCCTTGTGGG + Intronic
1139608211 16:68035310-68035332 CAGATCATGTAGAGCCTTGTAGG - Intronic
1139766999 16:69238959-69238981 CAGACCATGTACGGCCTTTTAGG - Intronic
1139978769 16:70836327-70836349 CAGGTCTTGCAAGGCCTTTTAGG + Intronic
1140101226 16:71919190-71919212 CAGACAATGCAGGACCATGTAGG - Intronic
1140834046 16:78777028-78777050 CAGATTTTGCATGACATTTTAGG + Intronic
1143092964 17:4460201-4460223 CAGATCATGTAGGATGTTGTGGG + Intronic
1143694499 17:8601910-8601932 CATATCATGCACAAACTTTTTGG - Intronic
1144444606 17:15315301-15315323 CAGATCATGCAGGGCCCTAATGG + Intronic
1146791803 17:35755074-35755096 TAGATCATGCAGGGCCTTGTAGG + Intronic
1148706738 17:49640706-49640728 CAGATTGTGCAGGACCCTTTTGG - Intronic
1149451861 17:56755934-56755956 CAAATCATGCAGGAGCTTGGGGG - Intergenic
1150113839 17:62526967-62526989 CAGATCACGCAGGAGCTTTTAGG - Intronic
1150123624 17:62622562-62622584 CAGGTCATACAGAACCCTTTGGG + Intergenic
1150944671 17:69731965-69731987 CAGAACCTGCAGGGCCTTTGGGG + Intergenic
1150944931 17:69734661-69734683 CAAATCAGGTAGGACCTTTTCGG - Intergenic
1151882906 17:76905541-76905563 CACAGAATGCAGGACCTCTTGGG - Intronic
1152520778 17:80855388-80855410 CAGCTCATGCAGCAGCGTTTCGG + Intronic
1153015487 18:579182-579204 GAGATGATGCAGGACATGTTGGG - Intergenic
1153018161 18:602945-602967 AAGGTCTTGCAGGACCTTGTAGG + Intronic
1153165857 18:2261588-2261610 CAGACCATACAGGACTTTGTGGG - Intergenic
1153200602 18:2643684-2643706 AAGATCATGCAGGGCCTTGGAGG - Intergenic
1155337522 18:24780036-24780058 CAGATCACACAGGACCTTGTAGG - Intergenic
1156294143 18:35774635-35774657 CAGATGATACAGGGCCTTCTAGG - Intergenic
1156809684 18:41232408-41232430 CAGATTATGTAGGGCCTTGTGGG - Intergenic
1157913804 18:51644598-51644620 CAGATCACGGAGAACCTTATAGG + Intergenic
1158543437 18:58376787-58376809 CAGGCCACGCAGGACCTTGTGGG - Intronic
1158866909 18:61646713-61646735 CAGATGATGCAAAACCTTTGAGG + Intergenic
1160071360 18:75631285-75631307 CAGGTCATGTTGGTCCTTTTTGG + Intergenic
1160940496 19:1618473-1618495 CAGGTCATGCGGGGCCTTGTGGG - Intronic
1160988438 19:1850924-1850946 CAGGTCATGCAGAACCCTATGGG + Intergenic
1161286468 19:3471056-3471078 CAGGTCATTCAGGGCCTTGTGGG + Intergenic
1161490374 19:4557913-4557935 CAGGTCGTGCAGGGCCTGTTGGG - Intronic
1161619195 19:5289533-5289555 CAGGTCGTGCAGGACCTGGTGGG - Intronic
1161621412 19:5299225-5299247 CAGGTCATGCAGGGCCTTGTGGG - Intronic
1161634238 19:5377234-5377256 CAGGTCATGCAGGGCCTTGTGGG + Intergenic
1161644489 19:5444680-5444702 TAGGTCATGCAGGGCCTTGTGGG - Intergenic
1161657167 19:5523396-5523418 CAAATCATGCAGGCCTTTGTGGG - Intergenic
1162148624 19:8629428-8629450 CAGGTCATGAAGGGCCTTGTGGG + Intergenic
1162837869 19:13333163-13333185 CAGATCAAGCAGGGGCTTATAGG - Intronic
1163000130 19:14362063-14362085 CAGATCCTGCAGGGCCCTGTGGG + Intergenic
1163221904 19:15927719-15927741 CAGAACATGTTGGACCTTGTAGG - Intronic
1165217917 19:34289929-34289951 ATGATCATGAAGGGCCTTTTTGG + Intronic
1165322674 19:35095980-35096002 CAGATCCTGTAGGGCCTTGTGGG + Intergenic
1165639706 19:37373899-37373921 CAGATCATGAACCACCTTGTTGG + Intronic
1165661326 19:37582989-37583011 CAAATCATGTAGGACCTTGTTGG - Intronic
1165933468 19:39375192-39375214 CAGGTCCTGCATGGCCTTTTAGG + Intronic
1166563672 19:43750164-43750186 CAAATCATGTAGGACCTGGTAGG - Intronic
1166634280 19:44435902-44435924 CAGATCACTCAGGGCCTCTTAGG + Intronic
1166690114 19:44817426-44817448 CAGACCAGGCAGCATCTTTTAGG + Intronic
1167297230 19:48658469-48658491 TAGATCATGCAGGGCTTTGTGGG + Intergenic
1167325087 19:48819479-48819501 CAGATCAGGCAGGGCCTTGAAGG - Intronic
1167490637 19:49790999-49791021 CAGACCCTGCAGGGCCTTGTTGG - Intronic
1167533280 19:50032234-50032256 CAGATCAAAGAGGACCTTTGAGG - Intronic
1167564535 19:50248176-50248198 CAGATCATGCAGGGTCTTAGGGG + Intronic
1167611195 19:50508438-50508460 CAGACCACGCAGGGCCTTGTGGG - Intronic
1168053746 19:53849220-53849242 CAGATCATGGAAGGCGTTTTAGG - Intergenic
926363612 2:12113175-12113197 CAGATCGTGCTGGGCCTTGTGGG + Intergenic
927002449 2:18812317-18812339 CAGCTCATGCAGGCCATTTCAGG + Intergenic
927601805 2:24449298-24449320 CAGATCATGTAGATCCTTGTAGG - Intergenic
928440788 2:31290228-31290250 CAGGTCATGCAGGGCCTTAAAGG - Intergenic
929408879 2:41674088-41674110 AAGATCATGCAGGATCTCATAGG + Intergenic
929982254 2:46692464-46692486 CAGATCATGCAGAACTTTGAAGG - Intergenic
930385203 2:50685772-50685794 AAGATGATGCATCACCTTTTAGG - Intronic
930697431 2:54426286-54426308 CAGACCATGAAGGACCTAATAGG - Intergenic
931065191 2:58578264-58578286 CAGATCATGCTGGACCTTGTGGG + Intergenic
931339211 2:61382280-61382302 CAGATTATTCAGGACCTTGTAGG - Intronic
932682068 2:73834957-73834979 TGGATCATGCAGGACTTTATGGG + Intronic
932760893 2:74438589-74438611 CAGATCATGCAGGGCCTTGAAGG - Intronic
932778531 2:74544394-74544416 CAGATCATAGAAGACCTTATAGG - Intronic
932831219 2:74991944-74991966 CAGATTATTCACAACCTTTTTGG + Intergenic
933075135 2:77914911-77914933 CAGATAATATAGGACCTATTTGG + Intergenic
935288437 2:101587879-101587901 CAGATTATGCAGAAGTTTTTAGG + Intergenic
935473926 2:103494625-103494647 CTGAACATGCAAGGCCTTTTTGG - Intergenic
936725448 2:115309530-115309552 AATATCATGCAGGATATTTTGGG + Intronic
936893798 2:117403930-117403952 CAGATCACATAGGAACTTTTAGG + Intergenic
937162402 2:119777054-119777076 CAGACCATGTAGGGCTTTTTTGG - Intronic
937208111 2:120249811-120249833 CAGATGATGCAGGGGCTTCTCGG - Intronic
937940791 2:127284321-127284343 CAGGTCTTGTAGGACCTTGTAGG - Intronic
939321200 2:140625049-140625071 GAGAACATGCAGGATCTTTCAGG + Intronic
939706520 2:145460276-145460298 TAAATTATGCAGGACCTTGTGGG + Intergenic
940224612 2:151388755-151388777 CAGATCATGATGGGCCTTCTAGG - Intergenic
940736042 2:157453633-157453655 TAGAACATGCAGGACCTTGAAGG - Intronic
940892518 2:159048747-159048769 AAAATCATACAGAACCTTTTTGG + Intronic
941043992 2:160652296-160652318 CAGAGCATGCAGGGCCTTCTAGG - Intergenic
941351504 2:164442835-164442857 AAGCTCTTGCAGGACCTTGTAGG + Intergenic
942177710 2:173350471-173350493 CAGATCATGTGGGACCTTCTTGG - Intergenic
942198356 2:173545409-173545431 CAGACCATGCAAAACCTTCTAGG + Intergenic
942428134 2:175880757-175880779 TAGATCATGCAGGACCTTCACGG + Intergenic
942664689 2:178304744-178304766 CAGTCCCTGCAGGACCTTGTAGG - Intronic
943699887 2:190978412-190978434 GAGTTGATGCAGGACCTGTTGGG - Intronic
944325777 2:198401825-198401847 CAGATCATGCAGGACCTTGTAGG - Intronic
944395529 2:199262213-199262235 CAGATCATGTAGGGCCTTGCAGG + Intergenic
944668573 2:201976528-201976550 AAGCTCATGTAGGACCTTGTAGG + Intergenic
945679785 2:212899895-212899917 CAGATCATTCAGGGCCTTATGGG + Intergenic
946460688 2:219865894-219865916 TAGATCTTGCAGGACCTTGAAGG - Intergenic
946657212 2:221961252-221961274 CAGAACACACAGGGCCTTTTAGG + Intergenic
947134621 2:226964853-226964875 CAGGTCACACAGGGCCTTTTAGG + Intronic
948086216 2:235250967-235250989 CAGAGCATGCAGGATTTTTAAGG + Intergenic
948202820 2:236142203-236142225 CAGATCACGTAGGACCTTGCAGG - Intergenic
948290746 2:236822564-236822586 CAGTTCATCCAGGCCATTTTAGG + Intergenic
948974323 2:241454230-241454252 CAGATTTTGCAGCAACTTTTTGG + Intronic
1169031959 20:2416541-2416563 CAGATTATGCAGAAATTTTTAGG + Intronic
1169280030 20:4259210-4259232 CACATCAGGCAGGACCCTTCTGG - Intergenic
1169618547 20:7478156-7478178 CAGAAGATGCATCACCTTTTAGG + Intergenic
1169783468 20:9333544-9333566 CAGATCGTTCAGGACCTTTTCGG + Intronic
1169792230 20:9423587-9423609 TAGCTCATGCAGTACATTTTGGG + Intronic
1169815290 20:9650176-9650198 CAGATCATCCAGTCCCTTGTAGG - Intronic
1170243072 20:14191837-14191859 CAGATCATATAGGGTCTTTTAGG + Intronic
1170293289 20:14795135-14795157 CAGACCGTGAAGGACCTTGTAGG + Intronic
1170464442 20:16610140-16610162 CAGATCATGTAAGGCCTTTGTGG - Intergenic
1170733237 20:18991789-18991811 CAGAATATGCAGGGCCTTCTAGG - Intergenic
1171152030 20:22835697-22835719 CAGATCCTGCAGGGCCTTGCAGG + Intergenic
1172199298 20:33114002-33114024 AAGACCCTGCAGGACCTTGTGGG - Intergenic
1172223662 20:33290220-33290242 CAGATCATACAAGGCCTCTTGGG + Intronic
1172807105 20:37619913-37619935 CAGAACATGCAGGACCTCGTAGG + Intergenic
1173029075 20:39337940-39337962 CAGATCATGGAGGACCTTCCAGG - Intergenic
1173338655 20:42134847-42134869 CAGATCATGCAAGACATTGCAGG - Intronic
1173418770 20:42881940-42881962 TGGATCATGCAGGATCTTATAGG + Intronic
1173559552 20:43993150-43993172 CGGATCATGCAGGACTTTGCAGG + Intronic
1173587446 20:44193615-44193637 CAGATCATGGAGGGCCTGGTAGG - Intergenic
1173688529 20:44940965-44940987 CAGATCATGCAGGGTCTCCTAGG - Intronic
1174115299 20:48222837-48222859 CAGATCCTGCAGGCCCTTGTGGG + Intergenic
1174199675 20:48798484-48798506 CAGAGCATGCAGGGCCTTCCAGG - Intronic
1175024665 20:55889156-55889178 CAGATTGTGCAGGGCCTTGTGGG + Intergenic
1176958184 21:15129999-15130021 TAGATCATGCAGGATCTTGAAGG + Intergenic
1177922371 21:27168712-27168734 CAGATCATATAGTACCTTGTGGG - Intergenic
1178974644 21:37210357-37210379 CAGATTATGCAGGAGTTTCTAGG + Intergenic
1179078011 21:38142448-38142470 CACACCATACAGGGCCTTTTGGG + Intronic
1181888521 22:26040848-26040870 CAGATGATGTAGGGCCTTGTAGG + Intergenic
1182190381 22:28453908-28453930 TAGATCATGTATGACCTTGTAGG - Intronic
1182642481 22:31779522-31779544 CAGTTCATGCAGGGCCTTCAAGG + Intronic
1183289417 22:36990454-36990476 CAGACCATGCAGCACATTCTGGG - Intergenic
1183380278 22:37487230-37487252 CAGCTCACGCAGGGCCTTGTGGG - Intergenic
1184419325 22:44370391-44370413 CAGAGCCTGCAGGGCCTTGTGGG + Intergenic
1184578346 22:45393337-45393359 CACAGCATCCAGGTCCTTTTGGG + Intronic
1184617395 22:45647285-45647307 CATATCATTCAGGACCTTCATGG - Intergenic
1184637801 22:45848971-45848993 CAGATCATGCAGGGTCTTCAAGG + Intergenic
949478729 3:4472998-4473020 TAGATCATGGAGGACCTTCTTGG - Intergenic
949842955 3:8340036-8340058 CACATCATTCAGGACCTTATAGG - Intergenic
950076552 3:10191458-10191480 TAGACCATGCAGGGCCTTGTAGG - Intronic
950835734 3:15917584-15917606 TAAATCATGCATCACCTTTTAGG + Intergenic
951277798 3:20710949-20710971 CAGATCATGCAAGGCCTTGTAGG + Intergenic
951738572 3:25895462-25895484 TGGATCATGTAGGACCTTGTAGG - Intergenic
952877051 3:37954807-37954829 AAGACCATGGAGGACCTTTAAGG + Intronic
953249503 3:41231448-41231470 CATAACATGCAGGACTTTCTAGG + Intronic
954219756 3:49145772-49145794 CAGATCTCATAGGACCTTTTGGG - Intergenic
955070888 3:55571695-55571717 CACATCATGCAGGACCACTCAGG - Intronic
955361778 3:58282183-58282205 TAGATCCTGTAGGACCTTATAGG + Intronic
955891213 3:63652092-63652114 CAGGCCATGCAGGAACTTTTAGG - Intergenic
955896463 3:63705910-63705932 CAGATCATCCAAAACCTGTTAGG + Intergenic
956368005 3:68526130-68526152 CAGAGCATGCAAAACCTCTTAGG - Intronic
957073925 3:75586608-75586630 CAGACCCTGCAGCAACTTTTCGG + Intergenic
957849449 3:85787799-85787821 CAGATCATGCAGGACTTGTTAGG - Intronic
958915388 3:100044612-100044634 CAGATTATACAGGGCCTTATAGG + Intronic
959208945 3:103351063-103351085 CAGATCATGTAGGATCTTTTAGG + Intergenic
959399637 3:105883914-105883936 CAGACCATGCAGGGCTTTGTAGG - Intergenic
959479221 3:106850944-106850966 CAGATCTAGTTGGACCTTTTAGG - Intergenic
959689431 3:109182632-109182654 CAGATCATGCAGGGCCTTGAAGG - Intergenic
959689727 3:109185836-109185858 CAGACCATGCAGAAACTTATAGG + Intergenic
959833913 3:110896302-110896324 CAGATCATCAAGGACCTGTAGGG - Intergenic
960486954 3:118264949-118264971 CAGATCATGTAGGGCCTTTCAGG + Intergenic
962072713 3:132048360-132048382 TGGATCATGCAGGACCTTGCAGG - Intronic
963219171 3:142788060-142788082 CAGACCATGCATGGCCTTGTAGG + Intronic
963644107 3:147892484-147892506 CAGGCCATGTAGGCCCTTTTAGG - Intergenic
963942947 3:151113384-151113406 AAGATCACACAGGAACTTTTAGG + Intronic
964155610 3:153581599-153581621 CAGATCATCCAGTGCCTTATAGG - Intergenic
964373950 3:156031269-156031291 CAGATCATGCAGGGCCCTGTTGG + Intergenic
964435996 3:156654412-156654434 CAAATCATGCATGGCCTTGTGGG + Intergenic
964466227 3:156996442-156996464 CACATCATGCAGGGCCTTGCAGG + Intronic
964763722 3:160158380-160158402 TGGATCATGCAGGGCCTTGTAGG - Intergenic
965247887 3:166298937-166298959 GAGATCGTGCAGGACCTTTAAGG - Intergenic
965289500 3:166861170-166861192 GAGATCATGCAGTTCCTCTTAGG - Intergenic
965690112 3:171346851-171346873 CAGATCATCCTGGGCCTTGTAGG + Intronic
965824264 3:172714707-172714729 CAGATCATTTAGGACCATGTAGG + Intergenic
966160495 3:176962491-176962513 CAGGTCATGCAGGACCTTGCAGG + Intergenic
966351312 3:179035135-179035157 CAGATCGTGTAGGGCCTTATAGG - Intronic
966351319 3:179035182-179035204 CAGAACATGTAGGGCCTTATAGG - Intronic
966351327 3:179035229-179035251 CAGATCATGTAGGGCCTTATAGG - Intronic
967399369 3:189043457-189043479 CATATCATGCAGGCCCTTTATGG + Intronic
967702578 3:192610704-192610726 CAGATCTTGCAGGGCCTTGCAGG - Intronic
968292858 3:197552461-197552483 CAGAACATGGAGGGCCTTGTAGG - Intronic
970498984 4:16657569-16657591 CAGATAATGTAGGGCCTTGTAGG - Intronic
971130557 4:23804617-23804639 CAGACCATACAGGGCCTTGTAGG - Intronic
971273123 4:25170316-25170338 CAGACCTTGCAGGGCCTTATAGG - Intronic
972154809 4:36146413-36146435 CTGATCATGTAGGGCCTTATCGG - Intronic
972615697 4:40695925-40695947 TTAATCTTGCAGGACCTTTTAGG - Intergenic
972886982 4:43504505-43504527 AGGATCATGCGTGACCTTTTAGG - Intergenic
973207781 4:47579715-47579737 CAAACCATGTAGGACCTTATAGG + Intronic
973628617 4:52797552-52797574 CAGAGCATGCAGGGCCTCTCAGG + Intergenic
974010092 4:56598733-56598755 CAGATCATGTAGGGCCTTGTAGG + Intronic
975441582 4:74417358-74417380 CAAATCATGCGGGAGCTTTTGGG + Intergenic
975854451 4:78608409-78608431 CAGATCATGCAGGACCTTTTTGG + Intronic
976683854 4:87788490-87788512 CAGATCATGAAGGGCTTTCTAGG + Intergenic
976763603 4:88576351-88576373 CATATCATGCAGACCCTTCTGGG - Intronic
977506897 4:97913778-97913800 CAGATTATGTAGAACATTTTGGG - Intronic
978103051 4:104866815-104866837 CAGATCATACAGGTCCTTGTAGG - Intergenic
978634660 4:110789937-110789959 CACATCATGCAGGAGGTTTTGGG + Intergenic
978905825 4:114004525-114004547 CAGATCTTGCAGGACCTAATAGG - Intergenic
979412645 4:120397380-120397402 CAGATCATGCAGTGGCTTCTGGG + Intergenic
979864446 4:125736333-125736355 CAGATCATGGAGGTCATTGTAGG + Intergenic
980091441 4:128447306-128447328 CAGATCATGTTGGACCTTCTAGG + Intergenic
980266889 4:130527709-130527731 CAGACCACGCAAGACCTTATAGG - Intergenic
981702296 4:147619934-147619956 CAGATCATGTTGGACCTTGATGG - Intronic
981721695 4:147808417-147808439 CAGATCATGCAGGGTCTTTCAGG + Intronic
982134031 4:152256950-152256972 CAGATCGTGTAGGGCATTTTAGG - Intergenic
982161155 4:152570807-152570829 CAGATCAAGCATGGCCTTATAGG + Intergenic
982350267 4:154407719-154407741 CAGACCCTGCAGGAACTTATGGG - Intronic
983239703 4:165218285-165218307 CAGATCACAAAGGGCCTTTTAGG - Intronic
983430409 4:167642887-167642909 CAGGTCATGCAGAAACTTCTAGG - Intergenic
984823268 4:183903187-183903209 CAGATCATGCCGGAACTTGCAGG - Intronic
985759534 5:1738168-1738190 CAGAGCATGAAGGATTTTTTAGG - Intergenic
987206806 5:15635703-15635725 CAGTTCATATAGGACCTTCTAGG + Intronic
987246943 5:16058749-16058771 TAGATCACGTAGGACCTTGTGGG + Intergenic
987493582 5:18614281-18614303 CAGATCTTGCAGTACCATGTTGG + Intergenic
988815995 5:34835745-34835767 CAGGTCATGGAGGGCCTTATAGG - Intergenic
989151257 5:38301918-38301940 AAGATTAAGCAGGACCTTTGAGG - Intronic
989807195 5:45624110-45624132 CAGATAATGCAGGACCTTATGGG + Intronic
990887189 5:60607940-60607962 CAGATCATGCAGAACTTTGTAGG + Intronic
992716993 5:79520783-79520805 CAGATCATGCAGTACCTCTTAGG - Intergenic
993714298 5:91259736-91259758 CAGCTCATGCAGGGCTTTGTAGG - Intergenic
993946214 5:94119901-94119923 CAGATCATGCAGGACTTTATAGG - Intergenic
994407803 5:99367360-99367382 CAAATCATGGAGGGCCTTATAGG - Intergenic
994926555 5:106123145-106123167 CAGTGCATGCAGGGCCTTTAGGG + Intergenic
995095906 5:108235660-108235682 CAGATCATGCGGGGCCTTATAGG - Intronic
995132232 5:108642735-108642757 CAGATCATGCAGAGCCTTCCTGG - Intergenic
995449749 5:112287627-112287649 CAGATCATGGAAGGCCTTATAGG - Intronic
995640843 5:114255546-114255568 CAGATAAGGCAGGGCCTTGTAGG + Intergenic
995982113 5:118117003-118117025 CAGATCATAAATGACCTTGTGGG + Intergenic
996257443 5:121422613-121422635 CAGAGCATGCAGGAACTTTTAGG + Intergenic
996550671 5:124726758-124726780 CAGGTCATGCAGGGCCTTGTAGG - Intronic
997018161 5:129962593-129962615 CAGACCATGCAGGATCTCATGGG - Intronic
997177521 5:131794883-131794905 CAGAGCATGAGGGAACTTTTTGG + Intronic
997448797 5:133965038-133965060 CAGATCATGTAGGATCTTGAAGG - Intronic
997705037 5:135942506-135942528 CAGACCTTGCAGGACCTTGTGGG - Intronic
997745695 5:136298396-136298418 CAGGTCATGCAGCACTTTGTAGG + Intronic
997958890 5:138303413-138303435 CAGATCGTGTAGGGCCTTGTAGG - Intronic
998010699 5:138693225-138693247 CAGATCATGAATGACCTTATAGG - Intronic
998120951 5:139577328-139577350 TAGTTCATGCAGGTTCTTTTGGG + Intronic
998588911 5:143456724-143456746 CAAATCATTCTGGGCCTTTTAGG - Intergenic
998692627 5:144604021-144604043 CAGATCAAGTAGGACCTTGCAGG + Intergenic
998727767 5:145037654-145037676 CAAATCATATAGGACTTTTTAGG - Intergenic
998881400 5:146648909-146648931 CAGATCACGCAGAATCTTATAGG + Intronic
998885694 5:146691681-146691703 CAGGTCATGAAGGGCCTTTTAGG - Intronic
999411270 5:151351936-151351958 TGGATCATGCAGGACCTTGTGGG - Intergenic
999559162 5:152781166-152781188 CAGATCATGTAGGGCCTTGCAGG - Intergenic
999856586 5:155601227-155601249 CATATCATTTAGGGCCTTTTAGG - Intergenic
999861393 5:155650687-155650709 CAGATCATGTAAGAACTTGTGGG + Intergenic
1000541028 5:162540233-162540255 CAGATCATGAAGGACTTTATGGG + Intergenic
1000901668 5:166918612-166918634 CAGACCACTCAGGACCTTCTAGG + Intergenic
1000978985 5:167796312-167796334 TAGATCATGCAGCCCCTTGTAGG - Intronic
1001017359 5:168153624-168153646 CAGATAATGCAGGGCCTTTGAGG + Intronic
1001517127 5:172363771-172363793 CAGATCAGGCAGGGCCTTTGGGG + Intronic
1001948719 5:175801066-175801088 GAGATCATGCAGGCCCTTCTAGG + Intronic
1002891843 6:1340145-1340167 GAGATCCTGGAGAACCTTTTGGG - Intergenic
1003051862 6:2787640-2787662 CAGATAAGGTGGGACCTTTTAGG + Intergenic
1003455600 6:6278791-6278813 CAGATCAAGCAGGGCTTTGTAGG + Intronic
1006710472 6:36064862-36064884 CAACTCATGTAGGACCTTTCAGG - Intronic
1008775764 6:55035719-55035741 CAGATCATGTAGGACCCCGTAGG - Intergenic
1010259243 6:73796266-73796288 CAGATCACCCAGGACCCTGTAGG - Intronic
1010308101 6:74348786-74348808 CAGATCATTCAGGAACCTGTAGG + Intergenic
1010535948 6:77030597-77030619 GAGATTATGCAACACCTTTTTGG + Intergenic
1011405715 6:87013437-87013459 GAGTTGATGGAGGACCTTTTTGG - Intronic
1011801365 6:91019740-91019762 CAGGTCCTGCAGGACTTTGTGGG - Intergenic
1012188126 6:96247298-96247320 CAGATCATGTAGGACTTTGTAGG + Intergenic
1012397032 6:98810453-98810475 CAGATCATACAGGGCATTGTAGG - Intergenic
1012783456 6:103592231-103592253 CAGATCATGTATGGCCTTGTAGG - Intergenic
1013548437 6:111183121-111183143 CAGATTGTGAAGGACCTTGTAGG - Intronic
1014805788 6:125827849-125827871 CAGATCATGCAGGGCCTTCTTGG + Intronic
1015209959 6:130685771-130685793 GAGATAATGAAGGACCTTGTAGG + Intergenic
1015228636 6:130887519-130887541 CAGATCATGCAGGGCCTTGGAGG - Intronic
1015911097 6:138168440-138168462 CAGATCATGAAAGTCCTTGTTGG + Intronic
1016492007 6:144615898-144615920 CTGATCATGTAGGACCTGGTAGG - Intronic
1016532658 6:145075466-145075488 CAGATTATACAGGACCTCATAGG + Intergenic
1017440761 6:154462558-154462580 AAGATCACACTGGACCTTTTTGG - Intronic
1019375364 7:688502-688524 CAGATCACGCAGGGCCTTGCTGG - Intronic
1020524060 7:9235835-9235857 CAGATCATGCAGCAACTTGTTGG + Intergenic
1021306071 7:19034117-19034139 CAGATTCTGAAGGACCTTTTAGG + Intronic
1021442304 7:20689978-20690000 CGGTTCATGCAGGGCCTCTTAGG + Intronic
1021874190 7:25033098-25033120 CAGGTCATGCAGGGCCTGATGGG + Intergenic
1021937575 7:25646410-25646432 CACCTCATGCAGGGCCTTTTGGG - Intergenic
1022606271 7:31817440-31817462 CAGATCATGCAGGGCTTTGGAGG + Intronic
1022656950 7:32328446-32328468 CAGATCATGCAGGGACTTGGAGG - Intergenic
1023066687 7:36384934-36384956 CAGATCATGCATGGCCTTGTAGG + Intronic
1023268095 7:38429806-38429828 CAGATCATTCTGGATTTTTTTGG - Intronic
1026241768 7:68581716-68581738 CAGATCATGTAGGGTCTTGTAGG - Intergenic
1026375526 7:69746721-69746743 CAGGTCATATAGGACCTTGTAGG + Intronic
1026450005 7:70520319-70520341 CAGATCAGGGAAGACCTTGTGGG - Intronic
1027421908 7:78025059-78025081 CAGATCATGCAGGCTTTTTTAGG - Intronic
1028433811 7:90778595-90778617 CAGATCACGAAGGGCCTTCTGGG - Intronic
1028658209 7:93235301-93235323 TAGATCATGTAGTACCTTATAGG + Intronic
1028751657 7:94390164-94390186 CAGATCAAAAAGGACCTTTTAGG - Intergenic
1028981752 7:96974964-96974986 CAGATCCTGAAGGGCCTTGTAGG - Intergenic
1029360975 7:100088604-100088626 CAGATCAGGCAGGGCCTTGCAGG + Intergenic
1029856724 7:103524950-103524972 GATATCAGGCAGGACCTTGTGGG - Intronic
1030487526 7:110189091-110189113 CAGATCATGCAGGACTTTGTAGG + Intergenic
1030618205 7:111760874-111760896 CAGATCATTCAGGTACTTTTTGG - Intronic
1031560477 7:123232172-123232194 CAGATTATCCAGGACCTTGTAGG - Intergenic
1032043544 7:128582725-128582747 CAGATCACGCAGGAGCTTTTAGG - Intergenic
1032327107 7:130939836-130939858 CAGATCATCAATGACCTTCTGGG + Intergenic
1032429178 7:131847058-131847080 CACATCATGCAGGACCTCTTTGG + Intergenic
1033133732 7:138767767-138767789 CAGATCATGGAGGACCCTGGGGG - Intronic
1034258335 7:149736793-149736815 CAGATCAGCCAGGACCCGTTCGG - Intergenic
1036505280 8:9349238-9349260 CAGATCATGCAGGGTCTTATCGG - Intergenic
1036598534 8:10238051-10238073 CAGATAGTGTAGGACCTTGTGGG - Intronic
1037316464 8:17604047-17604069 CAGACCATGGAGGGCCTTGTTGG + Intronic
1037462960 8:19131548-19131570 CAGGTCAGGCAGGGCCTTGTTGG + Intergenic
1041798883 8:61776275-61776297 CATATCCTGAAGCACCTTTTGGG + Intergenic
1041801642 8:61806966-61806988 CAAATAAAGCAGGACCTTATTGG + Intergenic
1041876343 8:62691628-62691650 CAGAACATGCAGGACTTAATAGG - Intronic
1042096903 8:65226144-65226166 CAGATCACGCAGGGCCTTGTAGG + Intergenic
1042150798 8:65781368-65781390 CAGATCATGCTGGACCTTTGTGG + Intronic
1042275976 8:67005954-67005976 CAGATCATAAAGGTCATTTTAGG - Intronic
1042939810 8:74096282-74096304 CAGATCATGCAGAGCCTCATTGG - Intergenic
1043551192 8:81374953-81374975 CAGATCCTGTAGGACTTTGTGGG + Intergenic
1044889826 8:96822607-96822629 CATATCATGCAGGACCTCCTGGG - Intronic
1044934473 8:97279448-97279470 CAGATCATACAGGGCCTTGCAGG - Intergenic
1045227389 8:100262568-100262590 CAGATCATGTGGGGCCTTTTGGG + Intronic
1045624730 8:104030495-104030517 CAGGTCATGTAGGGCCTTATAGG - Intronic
1045663092 8:104458270-104458292 CAGGTCATGCAGGACCTTATGGG - Intronic
1045977382 8:108145074-108145096 CAGATCATGCAGGACCCTCTTGG + Intergenic
1046078284 8:109338064-109338086 CAGATCATGAAGGATCATGTAGG + Intronic
1046214058 8:111118472-111118494 CAGAACATGCAGGATCATATGGG + Intergenic
1046453130 8:114420045-114420067 CAGATGCTGAAGGAGCTTTTGGG - Intergenic
1046814417 8:118568383-118568405 CAGATCATGCAGGATCTGGTAGG + Intronic
1046951724 8:120025887-120025909 CAGATCAGGTAGGACCGTTTGGG - Intronic
1047285027 8:123480345-123480367 CAGATCATGCAGGGTCTTTGTGG + Intergenic
1047348266 8:124049355-124049377 AGGATCATACAGGTCCTTTTAGG + Intronic
1047971867 8:130091502-130091524 CCGATCATGCAGGGCCCTGTGGG + Intronic
1048394575 8:134001942-134001964 CAGATCCTGCAGGAAGCTTTGGG - Intergenic
1048445349 8:134489068-134489090 CAGATCATGAAGGATCTTATAGG + Intronic
1048760183 8:137785827-137785849 GAAATCATGCACCACCTTTTAGG + Intergenic
1050412931 9:5385061-5385083 CAGATCATGTGGGACCTTCCAGG + Intronic
1051650650 9:19321017-19321039 CAGGTTATGCAGGATCTTTTAGG + Intronic
1055392530 9:75838390-75838412 CAGATCATGGAGAACCTGGTGGG - Intergenic
1055561267 9:77523864-77523886 CAGATTCTGCAGAACCTTTAAGG + Intronic
1055660122 9:78494872-78494894 CAGATCATGCAAGGCTTTGTGGG + Intergenic
1056223694 9:84474258-84474280 AAGAACATGCAGGATGTTTTAGG + Intergenic
1056289274 9:85126387-85126409 CAGGTCATGCAGGATCTTCTGGG + Intergenic
1056368014 9:85925583-85925605 CAGATCATGAAGGGCTCTTTTGG - Intergenic
1056736641 9:89215429-89215451 CTGTTTATGCAGGACCTTGTGGG - Intergenic
1057952605 9:99381835-99381857 CAGAACAGCCAGGAACTTTTTGG - Intergenic
1058532821 9:105924057-105924079 CAGATCCTGCAAGGCCTTGTGGG - Intergenic
1059348245 9:113646795-113646817 CAGATCACGCAGGGCCTTGAAGG - Intergenic
1059592187 9:115673675-115673697 CAGATCATGCATGGCTTTGTAGG - Intergenic
1059604029 9:115813461-115813483 CAGGTCATGAAGGACCATGTGGG - Intergenic
1059622292 9:116020279-116020301 CAGATCATTTGGGACCTTCTGGG - Intergenic
1059905236 9:118976404-118976426 AAAATCAGGCTGGACCTTTTAGG - Intergenic
1059917027 9:119115332-119115354 CAGATCATGAAGAACCTTCATGG - Intergenic
1060422999 9:123482907-123482929 TGGATCATGCAGGTCTTTTTAGG + Intronic
1060463655 9:123882931-123882953 CAGATCATGTAGGACTTTGTAGG - Intronic
1062535893 9:137020948-137020970 CACATCCTGCAGAACCTTCTGGG + Exonic
1186722695 X:12322577-12322599 CAGGTCATTCAGGGCCTTGTAGG + Intronic
1187202257 X:17146181-17146203 CAGATCGTACAGGGCCTTGTGGG - Intronic
1187237074 X:17477464-17477486 CAAGACATGCAGGATCTTTTGGG + Intronic
1187248494 X:17575270-17575292 CAGGTCATGCAGGGCCTTGCAGG - Intronic
1188232150 X:27677663-27677685 CAGGTCATGCAGGACCTTGCAGG + Intronic
1188799176 X:34505914-34505936 CAGACCATGCATGGCCTTATAGG - Intergenic
1189105991 X:38235819-38235841 CAGATCAAACAGGGCCTTTTTGG - Intronic
1189537986 X:41956206-41956228 CAGATCATGTAGGGCCTTGTAGG - Intergenic
1189705888 X:43758366-43758388 CAGATCATGTAGGAAGTCTTAGG - Intergenic
1190262163 X:48804244-48804266 CAGATCATGTGGAACCTTTGAGG - Intronic
1190336825 X:49267645-49267667 TAGACCACGCAGGACCTTGTAGG + Intergenic
1190489342 X:50965394-50965416 CAGATCATGTAGGATTTTGTAGG - Intergenic
1190702120 X:52996894-52996916 CAGATTATACAGGACCTTCTGGG + Intergenic
1190882193 X:54499600-54499622 TAGATTATGCAGGGCTTTTTAGG + Intergenic
1191058835 X:56272892-56272914 AAGATCCTGTAGGGCCTTTTAGG - Intronic
1191853700 X:65605624-65605646 TAGATCATGTAGGCTCTTTTGGG - Intronic
1192143245 X:68662469-68662491 CAGATCACGAAGGGCCTTATAGG - Intronic
1192273832 X:69610180-69610202 CAGATCATGTAGGGCCTTGTAGG + Intergenic
1192280119 X:69676116-69676138 CAGATCATGTAGGGCTTTGTAGG + Intronic
1192340777 X:70261663-70261685 CAGATCATGAAGGTCCTTGGAGG + Intergenic
1192555211 X:72083863-72083885 CAGATCGTGCAGGGCCTTCTAGG - Intergenic
1193256776 X:79357704-79357726 CAGATCATGTAGGACACTATAGG - Intergenic
1193515040 X:82452310-82452332 CAGATCATACCTGACCTTTGGGG + Intergenic
1193624707 X:83803842-83803864 TAGATCATGTAGGGCCTTGTAGG + Intergenic
1193869473 X:86779422-86779444 CAGATCATGTAAGACTTTATAGG + Intronic
1194423601 X:93708314-93708336 CAGATCATATAGGACCTTATAGG + Intronic
1194713699 X:97265761-97265783 CAAATCATGTAGGTCCTTGTTGG + Intronic
1194886887 X:99326968-99326990 CAGATCATTCATGACATGTTTGG - Intergenic
1195408582 X:104544271-104544293 CAGATCATAAAGGACCTTGTGGG - Intergenic
1195596736 X:106699685-106699707 CAGATCATGCAACTCCTTTTAGG - Intronic
1195677004 X:107514234-107514256 GAGATCACGCAGGGCCTTATGGG + Intergenic
1195691047 X:107625970-107625992 CTGATCATGCAGAACCTTATAGG - Intergenic
1195700832 X:107704426-107704448 CAGATCACGCAGGCACTTGTAGG + Intergenic
1195725717 X:107913912-107913934 AAAATCATGCAGGACTTTGTAGG - Intronic
1195898587 X:109773607-109773629 CAGATCACACAGGGCCTTGTAGG + Intergenic
1196286311 X:113884731-113884753 AAGATCATGAAGAGCCTTTTTGG - Intergenic
1196756981 X:119166612-119166634 CAGATCATGACAGACCTTTAAGG - Intergenic
1196764657 X:119231952-119231974 CAGATCCTGTAGGGCCTTGTAGG + Intergenic
1196848785 X:119917956-119917978 CAGATCACACAGGGCCTTGTAGG - Intronic
1197712919 X:129684952-129684974 CAGATCAGGCAGGGCCTTCTAGG + Intergenic
1197741707 X:129900057-129900079 CAGATCATGTAGGGCCTTGTAGG - Intergenic
1197881749 X:131173841-131173863 CAGATCATGTAGGGCCTTTTAGG + Intergenic
1198320441 X:135514398-135514420 CAGATCATGCAGGGCCTAGTTGG - Intergenic
1198380840 X:136081973-136081995 CAGATCATGTAAGGCCTTGTAGG - Intergenic
1198406107 X:136314340-136314362 CAGATCATGTAGTGCTTTTTAGG - Intronic
1198448235 X:136739922-136739944 CAGATCCTGGAGGACCTTGGAGG + Intronic
1198710430 X:139495661-139495683 CAGATCATGGAGGTCCTTGTAGG - Intergenic
1198789394 X:140327128-140327150 CAGATCATGAAGGGCCTCGTGGG + Intergenic
1198791548 X:140352344-140352366 CAGATCACACAGGGCCTTGTAGG + Intergenic
1198832835 X:140769276-140769298 CAGATCATGGAGGGCCTCATAGG + Intergenic
1199419226 X:147624143-147624165 AAGATCATGGGGGACCTTTTAGG + Intergenic
1199778274 X:151034728-151034750 CAGATCCTATAGGACCTTGTGGG - Intergenic
1200118902 X:153781280-153781302 CAGATGCTGCAGGGCCTTCTGGG + Exonic
1200913207 Y:8549150-8549172 CAAATCCTGCAGATCCTTTTGGG - Intergenic
1201503152 Y:14667949-14667971 CAGATCATTCAGGTCCCTGTTGG + Intronic