ID: 975860037

View in Genome Browser
Species Human (GRCh38)
Location 4:78667406-78667428
Sequence GCAGCTAGAAAGTATTAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975860037_975860040 9 Left 975860037 4:78667406-78667428 CCCACTTAATACTTTCTAGCTGC No data
Right 975860040 4:78667438-78667460 TCTGATCTGACTACATTATTGGG No data
975860037_975860039 8 Left 975860037 4:78667406-78667428 CCCACTTAATACTTTCTAGCTGC No data
Right 975860039 4:78667437-78667459 ATCTGATCTGACTACATTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975860037 Original CRISPR GCAGCTAGAAAGTATTAAGT GGG (reversed) Intergenic
No off target data available for this crispr