ID: 975861869

View in Genome Browser
Species Human (GRCh38)
Location 4:78686110-78686132
Sequence TGGGCTACTGGAGCTGCTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975861869_975861883 16 Left 975861869 4:78686110-78686132 CCCCAAGCAGCTCCAGTAGCCCA No data
Right 975861883 4:78686149-78686171 GACAGCCACAGATATGGGCTGGG No data
975861869_975861882 15 Left 975861869 4:78686110-78686132 CCCCAAGCAGCTCCAGTAGCCCA No data
Right 975861882 4:78686148-78686170 AGACAGCCACAGATATGGGCTGG No data
975861869_975861881 11 Left 975861869 4:78686110-78686132 CCCCAAGCAGCTCCAGTAGCCCA No data
Right 975861881 4:78686144-78686166 CCAAAGACAGCCACAGATATGGG No data
975861869_975861879 10 Left 975861869 4:78686110-78686132 CCCCAAGCAGCTCCAGTAGCCCA No data
Right 975861879 4:78686143-78686165 CCCAAAGACAGCCACAGATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975861869 Original CRISPR TGGGCTACTGGAGCTGCTTG GGG (reversed) Intergenic
No off target data available for this crispr