ID: 975861870

View in Genome Browser
Species Human (GRCh38)
Location 4:78686111-78686133
Sequence TTGGGCTACTGGAGCTGCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975861870_975861881 10 Left 975861870 4:78686111-78686133 CCCAAGCAGCTCCAGTAGCCCAA No data
Right 975861881 4:78686144-78686166 CCAAAGACAGCCACAGATATGGG No data
975861870_975861879 9 Left 975861870 4:78686111-78686133 CCCAAGCAGCTCCAGTAGCCCAA No data
Right 975861879 4:78686143-78686165 CCCAAAGACAGCCACAGATATGG No data
975861870_975861883 15 Left 975861870 4:78686111-78686133 CCCAAGCAGCTCCAGTAGCCCAA No data
Right 975861883 4:78686149-78686171 GACAGCCACAGATATGGGCTGGG No data
975861870_975861882 14 Left 975861870 4:78686111-78686133 CCCAAGCAGCTCCAGTAGCCCAA No data
Right 975861882 4:78686148-78686170 AGACAGCCACAGATATGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975861870 Original CRISPR TTGGGCTACTGGAGCTGCTT GGG (reversed) Intergenic