ID: 975861871

View in Genome Browser
Species Human (GRCh38)
Location 4:78686112-78686134
Sequence CTTGGGCTACTGGAGCTGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975861871_975861881 9 Left 975861871 4:78686112-78686134 CCAAGCAGCTCCAGTAGCCCAAG No data
Right 975861881 4:78686144-78686166 CCAAAGACAGCCACAGATATGGG No data
975861871_975861883 14 Left 975861871 4:78686112-78686134 CCAAGCAGCTCCAGTAGCCCAAG No data
Right 975861883 4:78686149-78686171 GACAGCCACAGATATGGGCTGGG No data
975861871_975861879 8 Left 975861871 4:78686112-78686134 CCAAGCAGCTCCAGTAGCCCAAG No data
Right 975861879 4:78686143-78686165 CCCAAAGACAGCCACAGATATGG No data
975861871_975861882 13 Left 975861871 4:78686112-78686134 CCAAGCAGCTCCAGTAGCCCAAG No data
Right 975861882 4:78686148-78686170 AGACAGCCACAGATATGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975861871 Original CRISPR CTTGGGCTACTGGAGCTGCT TGG (reversed) Intergenic