ID: 975861874

View in Genome Browser
Species Human (GRCh38)
Location 4:78686122-78686144
Sequence GGGAACTGCCCTTGGGCTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975861874_975861885 21 Left 975861874 4:78686122-78686144 CCAGTAGCCCAAGGGCAGTTCCC No data
Right 975861885 4:78686166-78686188 GCTGGGCAAGCAAATGACAGAGG No data
975861874_975861887 23 Left 975861874 4:78686122-78686144 CCAGTAGCCCAAGGGCAGTTCCC No data
Right 975861887 4:78686168-78686190 TGGGCAAGCAAATGACAGAGGGG No data
975861874_975861879 -2 Left 975861874 4:78686122-78686144 CCAGTAGCCCAAGGGCAGTTCCC No data
Right 975861879 4:78686143-78686165 CCCAAAGACAGCCACAGATATGG No data
975861874_975861882 3 Left 975861874 4:78686122-78686144 CCAGTAGCCCAAGGGCAGTTCCC No data
Right 975861882 4:78686148-78686170 AGACAGCCACAGATATGGGCTGG No data
975861874_975861883 4 Left 975861874 4:78686122-78686144 CCAGTAGCCCAAGGGCAGTTCCC No data
Right 975861883 4:78686149-78686171 GACAGCCACAGATATGGGCTGGG No data
975861874_975861886 22 Left 975861874 4:78686122-78686144 CCAGTAGCCCAAGGGCAGTTCCC No data
Right 975861886 4:78686167-78686189 CTGGGCAAGCAAATGACAGAGGG No data
975861874_975861881 -1 Left 975861874 4:78686122-78686144 CCAGTAGCCCAAGGGCAGTTCCC No data
Right 975861881 4:78686144-78686166 CCAAAGACAGCCACAGATATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975861874 Original CRISPR GGGAACTGCCCTTGGGCTAC TGG (reversed) Intergenic
No off target data available for this crispr