ID: 975861876

View in Genome Browser
Species Human (GRCh38)
Location 4:78686130-78686152
Sequence TGTCTTTGGGGAACTGCCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975861876_975861882 -5 Left 975861876 4:78686130-78686152 CCAAGGGCAGTTCCCCAAAGACA No data
Right 975861882 4:78686148-78686170 AGACAGCCACAGATATGGGCTGG No data
975861876_975861883 -4 Left 975861876 4:78686130-78686152 CCAAGGGCAGTTCCCCAAAGACA No data
Right 975861883 4:78686149-78686171 GACAGCCACAGATATGGGCTGGG No data
975861876_975861879 -10 Left 975861876 4:78686130-78686152 CCAAGGGCAGTTCCCCAAAGACA No data
Right 975861879 4:78686143-78686165 CCCAAAGACAGCCACAGATATGG No data
975861876_975861887 15 Left 975861876 4:78686130-78686152 CCAAGGGCAGTTCCCCAAAGACA No data
Right 975861887 4:78686168-78686190 TGGGCAAGCAAATGACAGAGGGG No data
975861876_975861881 -9 Left 975861876 4:78686130-78686152 CCAAGGGCAGTTCCCCAAAGACA No data
Right 975861881 4:78686144-78686166 CCAAAGACAGCCACAGATATGGG No data
975861876_975861886 14 Left 975861876 4:78686130-78686152 CCAAGGGCAGTTCCCCAAAGACA No data
Right 975861886 4:78686167-78686189 CTGGGCAAGCAAATGACAGAGGG No data
975861876_975861885 13 Left 975861876 4:78686130-78686152 CCAAGGGCAGTTCCCCAAAGACA No data
Right 975861885 4:78686166-78686188 GCTGGGCAAGCAAATGACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975861876 Original CRISPR TGTCTTTGGGGAACTGCCCT TGG (reversed) Intergenic