ID: 975861879

View in Genome Browser
Species Human (GRCh38)
Location 4:78686143-78686165
Sequence CCCAAAGACAGCCACAGATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975861875_975861879 -9 Left 975861875 4:78686129-78686151 CCCAAGGGCAGTTCCCCAAAGAC No data
Right 975861879 4:78686143-78686165 CCCAAAGACAGCCACAGATATGG No data
975861870_975861879 9 Left 975861870 4:78686111-78686133 CCCAAGCAGCTCCAGTAGCCCAA No data
Right 975861879 4:78686143-78686165 CCCAAAGACAGCCACAGATATGG No data
975861869_975861879 10 Left 975861869 4:78686110-78686132 CCCCAAGCAGCTCCAGTAGCCCA No data
Right 975861879 4:78686143-78686165 CCCAAAGACAGCCACAGATATGG No data
975861876_975861879 -10 Left 975861876 4:78686130-78686152 CCAAGGGCAGTTCCCCAAAGACA No data
Right 975861879 4:78686143-78686165 CCCAAAGACAGCCACAGATATGG No data
975861874_975861879 -2 Left 975861874 4:78686122-78686144 CCAGTAGCCCAAGGGCAGTTCCC No data
Right 975861879 4:78686143-78686165 CCCAAAGACAGCCACAGATATGG No data
975861871_975861879 8 Left 975861871 4:78686112-78686134 CCAAGCAGCTCCAGTAGCCCAAG No data
Right 975861879 4:78686143-78686165 CCCAAAGACAGCCACAGATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975861879 Original CRISPR CCCAAAGACAGCCACAGATA TGG Intergenic
No off target data available for this crispr