ID: 975861883

View in Genome Browser
Species Human (GRCh38)
Location 4:78686149-78686171
Sequence GACAGCCACAGATATGGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975861869_975861883 16 Left 975861869 4:78686110-78686132 CCCCAAGCAGCTCCAGTAGCCCA No data
Right 975861883 4:78686149-78686171 GACAGCCACAGATATGGGCTGGG No data
975861876_975861883 -4 Left 975861876 4:78686130-78686152 CCAAGGGCAGTTCCCCAAAGACA No data
Right 975861883 4:78686149-78686171 GACAGCCACAGATATGGGCTGGG No data
975861875_975861883 -3 Left 975861875 4:78686129-78686151 CCCAAGGGCAGTTCCCCAAAGAC No data
Right 975861883 4:78686149-78686171 GACAGCCACAGATATGGGCTGGG No data
975861874_975861883 4 Left 975861874 4:78686122-78686144 CCAGTAGCCCAAGGGCAGTTCCC No data
Right 975861883 4:78686149-78686171 GACAGCCACAGATATGGGCTGGG No data
975861871_975861883 14 Left 975861871 4:78686112-78686134 CCAAGCAGCTCCAGTAGCCCAAG No data
Right 975861883 4:78686149-78686171 GACAGCCACAGATATGGGCTGGG No data
975861870_975861883 15 Left 975861870 4:78686111-78686133 CCCAAGCAGCTCCAGTAGCCCAA No data
Right 975861883 4:78686149-78686171 GACAGCCACAGATATGGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975861883 Original CRISPR GACAGCCACAGATATGGGCT GGG Intergenic
No off target data available for this crispr