ID: 975870689

View in Genome Browser
Species Human (GRCh38)
Location 4:78776093-78776115
Sequence CCGTCGCGCCGCCGCCGCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975870689_975870693 -8 Left 975870689 4:78776093-78776115 CCGGGGCGGCGGCGGCGCGACGG No data
Right 975870693 4:78776108-78776130 CGCGACGGGCTGCGGTCCTGCGG No data
975870689_975870694 -7 Left 975870689 4:78776093-78776115 CCGGGGCGGCGGCGGCGCGACGG No data
Right 975870694 4:78776109-78776131 GCGACGGGCTGCGGTCCTGCGGG No data
975870689_975870695 0 Left 975870689 4:78776093-78776115 CCGGGGCGGCGGCGGCGCGACGG No data
Right 975870695 4:78776116-78776138 GCTGCGGTCCTGCGGGTTTGTGG No data
975870689_975870698 26 Left 975870689 4:78776093-78776115 CCGGGGCGGCGGCGGCGCGACGG No data
Right 975870698 4:78776142-78776164 GAGACGTCTAGCCCACTCCCTGG No data
975870689_975870700 30 Left 975870689 4:78776093-78776115 CCGGGGCGGCGGCGGCGCGACGG No data
Right 975870700 4:78776146-78776168 CGTCTAGCCCACTCCCTGGAGGG No data
975870689_975870699 29 Left 975870689 4:78776093-78776115 CCGGGGCGGCGGCGGCGCGACGG No data
Right 975870699 4:78776145-78776167 ACGTCTAGCCCACTCCCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975870689 Original CRISPR CCGTCGCGCCGCCGCCGCCC CGG (reversed) Intergenic
No off target data available for this crispr