ID: 975870693

View in Genome Browser
Species Human (GRCh38)
Location 4:78776108-78776130
Sequence CGCGACGGGCTGCGGTCCTG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975870674_975870693 30 Left 975870674 4:78776055-78776077 CCGCCAACGGCCACGAGTGGCGG No data
Right 975870693 4:78776108-78776130 CGCGACGGGCTGCGGTCCTGCGG No data
975870689_975870693 -8 Left 975870689 4:78776093-78776115 CCGGGGCGGCGGCGGCGCGACGG No data
Right 975870693 4:78776108-78776130 CGCGACGGGCTGCGGTCCTGCGG No data
975870677_975870693 27 Left 975870677 4:78776058-78776080 CCAACGGCCACGAGTGGCGGGCG 0: 1
1: 0
2: 0
3: 4
4: 37
Right 975870693 4:78776108-78776130 CGCGACGGGCTGCGGTCCTGCGG No data
975870680_975870693 20 Left 975870680 4:78776065-78776087 CCACGAGTGGCGGGCGGCGCGGG No data
Right 975870693 4:78776108-78776130 CGCGACGGGCTGCGGTCCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975870693 Original CRISPR CGCGACGGGCTGCGGTCCTG CGG Intergenic
No off target data available for this crispr