ID: 975870694

View in Genome Browser
Species Human (GRCh38)
Location 4:78776109-78776131
Sequence GCGACGGGCTGCGGTCCTGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975870689_975870694 -7 Left 975870689 4:78776093-78776115 CCGGGGCGGCGGCGGCGCGACGG No data
Right 975870694 4:78776109-78776131 GCGACGGGCTGCGGTCCTGCGGG No data
975870680_975870694 21 Left 975870680 4:78776065-78776087 CCACGAGTGGCGGGCGGCGCGGG No data
Right 975870694 4:78776109-78776131 GCGACGGGCTGCGGTCCTGCGGG No data
975870677_975870694 28 Left 975870677 4:78776058-78776080 CCAACGGCCACGAGTGGCGGGCG 0: 1
1: 0
2: 0
3: 4
4: 37
Right 975870694 4:78776109-78776131 GCGACGGGCTGCGGTCCTGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975870694 Original CRISPR GCGACGGGCTGCGGTCCTGC GGG Intergenic
No off target data available for this crispr