ID: 975870696

View in Genome Browser
Species Human (GRCh38)
Location 4:78776124-78776146
Sequence GTCTCAGGCCACAAACCCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975870696_975870700 -1 Left 975870696 4:78776124-78776146 CCTGCGGGTTTGTGGCCTGAGAC No data
Right 975870700 4:78776146-78776168 CGTCTAGCCCACTCCCTGGAGGG No data
975870696_975870702 4 Left 975870696 4:78776124-78776146 CCTGCGGGTTTGTGGCCTGAGAC No data
Right 975870702 4:78776151-78776173 AGCCCACTCCCTGGAGGGGCCGG No data
975870696_975870698 -5 Left 975870696 4:78776124-78776146 CCTGCGGGTTTGTGGCCTGAGAC No data
Right 975870698 4:78776142-78776164 GAGACGTCTAGCCCACTCCCTGG No data
975870696_975870701 0 Left 975870696 4:78776124-78776146 CCTGCGGGTTTGTGGCCTGAGAC No data
Right 975870701 4:78776147-78776169 GTCTAGCCCACTCCCTGGAGGGG No data
975870696_975870699 -2 Left 975870696 4:78776124-78776146 CCTGCGGGTTTGTGGCCTGAGAC No data
Right 975870699 4:78776145-78776167 ACGTCTAGCCCACTCCCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975870696 Original CRISPR GTCTCAGGCCACAAACCCGC AGG (reversed) Intergenic