ID: 975870698

View in Genome Browser
Species Human (GRCh38)
Location 4:78776142-78776164
Sequence GAGACGTCTAGCCCACTCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975870696_975870698 -5 Left 975870696 4:78776124-78776146 CCTGCGGGTTTGTGGCCTGAGAC No data
Right 975870698 4:78776142-78776164 GAGACGTCTAGCCCACTCCCTGG No data
975870689_975870698 26 Left 975870689 4:78776093-78776115 CCGGGGCGGCGGCGGCGCGACGG No data
Right 975870698 4:78776142-78776164 GAGACGTCTAGCCCACTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975870698 Original CRISPR GAGACGTCTAGCCCACTCCC TGG Intergenic
No off target data available for this crispr