ID: 975870701

View in Genome Browser
Species Human (GRCh38)
Location 4:78776147-78776169
Sequence GTCTAGCCCACTCCCTGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 99}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975870696_975870701 0 Left 975870696 4:78776124-78776146 CCTGCGGGTTTGTGGCCTGAGAC No data
Right 975870701 4:78776147-78776169 GTCTAGCCCACTCCCTGGAGGGG 0: 1
1: 0
2: 1
3: 12
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975870701 Original CRISPR GTCTAGCCCACTCCCTGGAG GGG Intergenic
903363107 1:22789444-22789466 GTTTAGCCCACTCACTGCACTGG - Intronic
905302912 1:36997783-36997805 GCCTAGCCCACATCCTGGAAAGG + Intronic
905866041 1:41377378-41377400 CTCTAGCCTCCTCCCTGGTGGGG + Intronic
906058940 1:42936051-42936073 TTCTAGACCACTGCCAGGAGGGG + Intronic
906689029 1:47780610-47780632 GTCAAGCAGACTTCCTGGAGGGG + Intronic
909423276 1:75491097-75491119 GACTAAGCCAATCCCTGGAGAGG - Intronic
913130464 1:115834151-115834173 CTCTTCCCCTCTCCCTGGAGAGG + Intergenic
913572175 1:120131721-120131743 GTCCCGCCCTCTCCATGGAGGGG - Intergenic
920561873 1:206944694-206944716 GTCTTGCCCTCTCTCTGGAGGGG - Intronic
920939391 1:210467054-210467076 GTCTAGGTCACTCCCAGGAAAGG - Intronic
1066746066 10:38604790-38604812 GTCCCTCCCACTCCCTGGGGGGG + Intergenic
1071503432 10:86219210-86219232 GTCTAGCCCATTCCCTCAAGGGG + Intronic
1072531316 10:96322069-96322091 CTCTGGCGCTCTCCCTGGAGAGG - Intronic
1077642128 11:3890861-3890883 TTCTGGCCCAATACCTGGAGAGG - Intronic
1082005952 11:47419055-47419077 TTCTTGCCCCCTCCCTGGACAGG - Intronic
1083331547 11:61900654-61900676 CCCTAGCACACTCCCTGGAGAGG - Intronic
1083731878 11:64656686-64656708 GCCTGGGCCCCTCCCTGGAGGGG - Intronic
1084180171 11:67442144-67442166 GTCATTCCCACTCCATGGAGGGG - Intronic
1084562060 11:69910746-69910768 GTCTTGACCAGTCCCAGGAGAGG + Intergenic
1084765859 11:71307968-71307990 GTATAACCCAGACCCTGGAGAGG - Intergenic
1085219282 11:74859758-74859780 GGCTAGCCCACATCCTCGAGTGG + Intronic
1085325878 11:75606256-75606278 GTATGGCCCACTGCCTGGGGTGG - Intronic
1085457644 11:76674235-76674257 CTCTAGGCCACCTCCTGGAGGGG + Intergenic
1088927031 11:114312879-114312901 CTCTTGCCTTCTCCCTGGAGAGG + Exonic
1094165281 12:27436785-27436807 ATCTAGCCCATTACCAGGAGGGG - Intergenic
1101195042 12:102373037-102373059 GTTGAGCCCACTTCATGGAGTGG - Intergenic
1102907476 12:116687963-116687985 TTTTAGGCTACTCCCTGGAGCGG + Intergenic
1104472953 12:129045325-129045347 CTCTAGGCCACCCCCAGGAGGGG + Intergenic
1104780655 12:131417818-131417840 GTCTAGGGCTCGCCCTGGAGTGG + Intergenic
1106080403 13:26495903-26495925 CTCCAGCCCACTCCCTGCTGGGG - Intergenic
1108074393 13:46664524-46664546 GTCTAGCCTACTCCATGGCTAGG - Intronic
1112988480 13:105481443-105481465 GTCTGCCCCACTCTCTGAAGTGG + Intronic
1115346665 14:32350119-32350141 GTCTAGCCCACCCTCAGGAGTGG - Intronic
1115757310 14:36542362-36542384 GTCCAGCCCACACTCAGGAGGGG - Intergenic
1115852030 14:37596206-37596228 CTCCAGCTCACTCCCTGAAGCGG - Intronic
1116612237 14:47090620-47090642 ATCTGGCCCACTCCCTGGAAGGG - Intronic
1117621862 14:57595469-57595491 GTCCAGCCCACACTCTGGTGTGG + Intronic
1118321801 14:64757756-64757778 GGCTGGCCAACTCCCTGGAGGGG + Intronic
1122357190 14:101130867-101130889 GTCCAGCCCACACACTGGAGGGG + Intergenic
1122430476 14:101637028-101637050 ATCTAGGGCACTCTCTGGAGAGG - Intergenic
1128388396 15:67166446-67166468 GTCTGGACGCCTCCCTGGAGGGG + Intronic
1130406811 15:83609930-83609952 GTCTAATCCACCACCTGGAGTGG + Intronic
1130984175 15:88833986-88834008 GTCTAGACCCCTCCCCAGAGTGG + Intronic
1133401531 16:5490762-5490784 TTCTAGCCCACGGCCTGCAGGGG - Intergenic
1134120163 16:11578225-11578247 GTCCAGCCCACACACAGGAGAGG - Intronic
1136736995 16:32474854-32474876 GTCCCTCCCACTCCCTGGGGGGG - Intergenic
1139431742 16:66914381-66914403 GCCTTGACCACGCCCTGGAGAGG - Exonic
1203016076 16_KI270728v1_random:354723-354745 GTCCCTCCCACTCCCTGGGGGGG + Intergenic
1203034411 16_KI270728v1_random:627881-627903 GTCCCTCCCACTCCCTGGGGGGG + Intergenic
1142610828 17:1108638-1108660 GCCTCGCCGCCTCCCTGGAGCGG - Intronic
1143405684 17:6675731-6675753 GACGAGCCCACTCCCTGCACAGG + Intergenic
1145985358 17:29042519-29042541 GGCCAGCCCAGTGCCTGGAGGGG - Intronic
1148550799 17:48550029-48550051 CTCTACCCCACTCCCGGGCGTGG + Exonic
1151347194 17:73509363-73509385 GTGGAGCCCCTTCCCTGGAGGGG - Intronic
1160142815 18:76340428-76340450 GTTTTTCCCACTCCCTGGAGGGG - Intergenic
1160740561 19:683563-683585 GGCTTGTCCACTGCCTGGAGAGG - Intergenic
1162151612 19:8649661-8649683 GTCCAGCCCAGTCCCTGGGCAGG + Intergenic
1164492806 19:28729868-28729890 CTCTACCCCACTGCCTGGTGCGG - Intergenic
925404854 2:3599439-3599461 TTCTAGCCCTTTCCCTGGACTGG + Intronic
925503907 2:4539260-4539282 CTCTAGCCCACTGAGTGGAGGGG - Intergenic
926705326 2:15833475-15833497 CTCTAACCCACTCCCTGGCCAGG - Intergenic
928375849 2:30772564-30772586 CTCTAGCTCACTCCCTGGTGTGG + Intronic
934308469 2:91843982-91844004 GTCCCTCCCACTCCCTGGGGGGG + Intergenic
937692096 2:124768036-124768058 AGCTAGCCCACTCTCTGGTGTGG - Intronic
948912967 2:241014368-241014390 GTCAAGTCCACACCCAGGAGTGG + Intronic
1173316434 20:41948915-41948937 TTCTAGCCCTTTCCATGGAGGGG + Intergenic
1174109352 20:48187426-48187448 ATCCAGCCCCCTCCTTGGAGAGG - Intergenic
1174507502 20:51026024-51026046 GGCTGGCCCCCACCCTGGAGTGG + Intergenic
1175764734 20:61584506-61584528 GGCTCTCCCACTCCATGGAGTGG - Intronic
1178344367 21:31812195-31812217 GCCAAGCCCCCTCCCTGGGGTGG + Intergenic
1181966283 22:26658527-26658549 CTCCAGGACACTCCCTGGAGAGG + Intergenic
1183521870 22:38300338-38300360 GCCTGGCCCACCCCGTGGAGAGG + Intronic
1184157335 22:42676653-42676675 CTCAAGCCCAAACCCTGGAGAGG + Intergenic
950422442 3:12906870-12906892 CTCTAGCCCACAGCCTGCAGAGG + Intronic
951810386 3:26692344-26692366 GTCTAGCACAGTTCCTGGTGTGG - Intronic
952979519 3:38723540-38723562 GTGTCGTCCACTCCCTGCAGGGG + Exonic
954776809 3:53026824-53026846 GTTTTGCCCTGTCCCTGGAGAGG + Intronic
956196783 3:66661191-66661213 CTCTAGCCTTATCCCTGGAGAGG + Intergenic
961202298 3:125055173-125055195 GTCGAGCCCTGTACCTGGAGAGG + Intronic
964231725 3:154478024-154478046 GTCTAGCACAGTCCCCGGTGTGG - Intergenic
966457367 3:180133109-180133131 TTCTAGCCCCCTCTCTGCAGTGG - Intergenic
969457182 4:7306777-7306799 GTGTGGCCCCGTCCCTGGAGGGG + Intronic
975870701 4:78776147-78776169 GTCTAGCCCACTCCCTGGAGGGG + Intergenic
978708506 4:111747378-111747400 GCTTAGACCAGTCCCTGGAGAGG - Intergenic
981263961 4:142758537-142758559 TTCTAGTCCACTCCCTGTTGAGG - Intronic
987034635 5:14007381-14007403 GTCACACCCACTCCCTGGGGTGG + Intergenic
993564551 5:89457336-89457358 TTCTAGCCAACACACTGGAGGGG - Intergenic
1001383791 5:171321439-171321461 GCCTAGCCCCCTCACGGGAGAGG - Intergenic
1002620322 5:180483590-180483612 GACTAACCCACTGCCTGCAGAGG + Intergenic
1004453398 6:15768740-15768762 GCCTAGGCCACTCTCAGGAGTGG - Intergenic
1007955883 6:45917471-45917493 TTGTGGCCAACTCCCTGGAGAGG + Intronic
1018433350 6:163740710-163740732 GTTTAGCCCAGTACCTGGCGTGG - Intergenic
1019437582 7:1029950-1029972 GTCCTGCCCACTGCCTGCAGCGG + Intronic
1019590449 7:1827813-1827835 GTCTAGCCCGGGCCCAGGAGGGG - Intronic
1022494405 7:30844081-30844103 TTGTAGCCCACCCCCTGGACTGG + Intronic
1029483766 7:100827359-100827381 GTCTCCCCCCCTCCCTGGAGTGG + Exonic
1031912696 7:127534380-127534402 TTCTAGCCAGCTCCCTGGTGAGG - Intergenic
1035426923 7:158784140-158784162 GTCTTGCCCACCCCCAGTAGAGG - Intronic
1035787500 8:2273218-2273240 GTCTATCCTGCTCCCTGGAGGGG + Intergenic
1035805308 8:2448498-2448520 GTCTATCCTGCTCCCTGTAGGGG - Intergenic
1037888219 8:22606280-22606302 TACTAGCCCACTACCAGGAGAGG - Intronic
1041964485 8:63659016-63659038 TTCTGGAGCACTCCCTGGAGAGG + Intergenic
1048833161 8:138496134-138496156 TTCAAGCCCAGTCACTGGAGGGG - Intronic
1053346505 9:37382442-37382464 GTCTTGCCCACTCACTCGACTGG - Intergenic
1053375027 9:37599031-37599053 TTCTAGCCATCTCCCTGCAGAGG + Intronic
1057199625 9:93133285-93133307 GTCTGGTCCACGCCATGGAGAGG + Intronic
1187389882 X:18878983-18879005 GTCTAGTCCACTTCCTGGGAGGG - Intergenic
1192208255 X:69110197-69110219 TTCTGCCCCACTCCCTGGAGTGG + Intergenic
1195126403 X:101813402-101813424 CTCTTGCCTGCTCCCTGGAGTGG - Intergenic
1195179179 X:102339934-102339956 CTCTTGCCTGCTCCCTGGAGTGG + Intergenic
1199730461 X:150627143-150627165 GTCTAGCCCGCTCACTGGAGTGG + Intronic
1200403529 Y:2784584-2784606 GTGAAGCACACTCCCAGGAGAGG - Intergenic
1200835733 Y:7729551-7729573 GCCCAGCTCACCCCCTGGAGAGG - Intergenic