ID: 975870702

View in Genome Browser
Species Human (GRCh38)
Location 4:78776151-78776173
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975870696_975870702 4 Left 975870696 4:78776124-78776146 CCTGCGGGTTTGTGGCCTGAGAC No data
Right 975870702 4:78776151-78776173 AGCCCACTCCCTGGAGGGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type