ID: 975871075

View in Genome Browser
Species Human (GRCh38)
Location 4:78778791-78778813
Sequence GGTCTGCCTGATCATAAGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 68}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975871075 Original CRISPR GGTCTGCCTGATCATAAGAT TGG Intronic
903581389 1:24373449-24373471 GGTATGCCAGATCATAAAAGGGG + Intronic
913149710 1:116028739-116028761 AGTGTGCCTGAACATAGGATGGG - Intronic
919982222 1:202649264-202649286 GGTCTCCCAGATCATATGCTGGG + Intronic
1067359647 10:45566808-45566830 GGATTGCCAGATCATACGATAGG + Intronic
1067575707 10:47407084-47407106 GGTGTGGCTGATTATAAGATAGG + Intergenic
1070190412 10:74106906-74106928 TGACTGCCTCATCATAAGAGAGG + Intronic
1071071539 10:81699535-81699557 GGTCTGCTTGATCAAGAGCTGGG - Intergenic
1081306607 11:41519509-41519531 GGCCTGACTGATGATAAGCTTGG + Intergenic
1086844181 11:91728052-91728074 AGTCTGTCTGATCATAACCTTGG - Intergenic
1086846596 11:91757470-91757492 AGTCTTCCTTATCATAATATTGG - Intergenic
1088687927 11:112300166-112300188 GGTCTGGCAGATGATGAGATGGG - Intergenic
1091830755 12:3549809-3549831 GCTCTGCCTGATGATATTATCGG + Intronic
1098965668 12:76785699-76785721 GGTTTGCCTGAGCCTGAGATGGG + Intronic
1099496779 12:83357929-83357951 GATTTACCTGATCATAAGAGTGG - Intergenic
1106973629 13:35177628-35177650 GGAGTAACTGATCATAAGATTGG - Intronic
1108864272 13:54903664-54903686 AGTTTCCCTGATCATAAGATGGG + Intergenic
1110844372 13:80177468-80177490 GGGCTGCCAGATCATAAGGGGGG - Intergenic
1111593622 13:90382484-90382506 GGTCTTCATGATCTTAAGGTGGG - Intergenic
1111644556 13:91015096-91015118 GCTCTTCCTGATAATACGATAGG + Intergenic
1116817815 14:49599672-49599694 GATCCGCCGGATCATAAGACCGG - Intronic
1119988833 14:79171633-79171655 TATATGCCTGATCATAAGAGTGG + Intronic
1127393839 15:58527923-58527945 GGGCTGCCTGATGAGAAAATGGG - Intronic
1127761074 15:62139620-62139642 GGTCTGCCTGAGAAAAAGCTGGG + Intergenic
1133634953 16:7656457-7656479 GCTCTCCCTGAACACAAGATAGG - Intronic
1141302155 16:82827028-82827050 CCTCTGCCTGATGATAAAATAGG + Intronic
1143916370 17:10296319-10296341 GGTCTTCCACACCATAAGATAGG - Intergenic
1146689513 17:34863582-34863604 GGTCTGCCTGGTCCTCAGATGGG - Intergenic
1148509444 17:48156167-48156189 GCTCTGCCTGAACATGAAATAGG - Intronic
1151081394 17:71333605-71333627 GGGCTGCCTGTTCATAAGTTTGG - Intergenic
1157829224 18:50841120-50841142 AGTCTCCCTGATTATAAAATAGG + Intergenic
1159889622 18:73941439-73941461 GGTTTGCCTGGTCAGAAGAGGGG + Intergenic
1168417338 19:56176868-56176890 GGTCGGCCTGATCCGATGATGGG + Intronic
929966799 2:46542728-46542750 GATCCGCCGGATCATAAGACCGG - Exonic
940465962 2:154026866-154026888 GGTATGCCTCATCATGAGAATGG + Intronic
946839742 2:223808544-223808566 GGTCTGCCTAATGCAAAGATGGG - Intronic
1170823135 20:19771148-19771170 GGTCTGCCTGGTCAAACCATTGG + Intergenic
1179263110 21:39776007-39776029 TGTCTGCATGATGAAAAGATTGG + Intronic
1180259552 21:46659498-46659520 GGTTTGCCTGTTCACATGATTGG - Intronic
1180426477 22:15194684-15194706 TGTCTGCCTTATCAAAAGAAAGG + Intergenic
1181427301 22:22851977-22851999 GGTCTGCCTGAGCACACGACGGG + Intronic
1181428236 22:22857742-22857764 GGTCTCTCTTATCATAAGAAGGG - Intronic
1182000025 22:26912783-26912805 GGACAGCCTGATCTGAAGATGGG - Intergenic
950500764 3:13362084-13362106 GGTCTCCCTGATCATGCTATAGG + Intronic
953237005 3:41115640-41115662 AGTCTGTCTAATCATAAGTTTGG + Intergenic
956030980 3:65037643-65037665 GGTCTGCAGGATTATAAGGTTGG - Intergenic
956166200 3:66400083-66400105 GGACTGCCTGCTCATAAAAAGGG + Intronic
961257544 3:125569533-125569555 GTTCTGCGTGTTCATAAGTTTGG - Intronic
975871075 4:78778791-78778813 GGTCTGCCTGATCATAAGATTGG + Intronic
977517866 4:98044958-98044980 GGTCTGCCTCACCATGAGACAGG + Intronic
979051683 4:115943067-115943089 AGTCTGCCTGAAAATAACATGGG - Intergenic
979886809 4:126037378-126037400 TGTCTGCCAGAACATAATATTGG + Intergenic
980829020 4:138107169-138107191 GTTCTGACTGATCATAAACTAGG - Intergenic
986785247 5:11108240-11108262 GGTCTGCGGGATCCTAAGACAGG + Intronic
991177731 5:63709670-63709692 GGTTTTCATGATCATAAGTTTGG - Intergenic
993966829 5:94369282-94369304 GGTGGGCCTGATCATATCATTGG + Intronic
995884349 5:116877272-116877294 AATCTGCCTGATACTAAGATGGG - Intergenic
996971502 5:129374170-129374192 GGTCTGGCAAAACATAAGATAGG - Intergenic
998168274 5:139856756-139856778 GGTCTGCCTGTGAATCAGATAGG - Intronic
999796370 5:154993308-154993330 TATCTGCCTGAGCATAATATTGG + Intergenic
1001025572 5:168221639-168221661 GAACTGGCTGATCATAAAATGGG - Intronic
1006877629 6:37312430-37312452 GGTCTGCCTTATCAGAACTTGGG + Intronic
1011864070 6:91799307-91799329 AGATTGCCTGAGCATAAGATGGG - Intergenic
1018331671 6:162734625-162734647 ACTCTGCCTTTTCATAAGATTGG - Intronic
1032574802 7:133041965-133041987 AGTCTGCCTGGGCATAAGTTAGG + Intronic
1040942799 8:52850463-52850485 GGTCTGCTTTATCATAGGCTAGG + Intergenic
1042461679 8:69076524-69076546 GGTTTTCCTTCTCATAAGATAGG - Intergenic
1046739025 8:117809290-117809312 AGTCTTCCTTATCTTAAGATAGG - Intronic
1047773330 8:128048599-128048621 GGTCTGACTCACCATCAGATGGG - Intergenic
1047898741 8:129397029-129397051 GGTCTTCCTTAGCATAAGGTGGG - Intergenic
1055744155 9:79424434-79424456 GCTCTGCCTAATGATAAGAATGG + Intergenic
1187419071 X:19119436-19119458 GGTTTTCCTGACCACAAGATAGG - Intronic
1188905154 X:35782783-35782805 GGTCTCCCTGGGCATAAGTTGGG - Intergenic
1195369469 X:104158713-104158735 GGACTGCCTGATGATAAGTTGGG - Intergenic
1201310683 Y:12596073-12596095 GGACTGCCTGATTAATAGATTGG + Intergenic