ID: 975871809

View in Genome Browser
Species Human (GRCh38)
Location 4:78787460-78787482
Sequence GTCTAACGGTAGTGGCTCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 40
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 36}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975871809_975871817 14 Left 975871809 4:78787460-78787482 CCCTTGAGCCACTACCGTTAGAC 0: 1
1: 0
2: 0
3: 3
4: 36
Right 975871817 4:78787497-78787519 GTAGTCTAAAGTATGTGCTTTGG 0: 1
1: 0
2: 2
3: 8
4: 159
975871809_975871815 -9 Left 975871809 4:78787460-78787482 CCCTTGAGCCACTACCGTTAGAC 0: 1
1: 0
2: 0
3: 3
4: 36
Right 975871815 4:78787474-78787496 CCGTTAGACAGAGTGGGAGCTGG 0: 1
1: 0
2: 0
3: 9
4: 93
975871809_975871816 -8 Left 975871809 4:78787460-78787482 CCCTTGAGCCACTACCGTTAGAC 0: 1
1: 0
2: 0
3: 3
4: 36
Right 975871816 4:78787475-78787497 CGTTAGACAGAGTGGGAGCTGGG 0: 1
1: 0
2: 2
3: 7
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975871809 Original CRISPR GTCTAACGGTAGTGGCTCAA GGG (reversed) Intronic
902703436 1:18188849-18188871 GGCTAAGGGTAAAGGCTCAAGGG - Intronic
907764507 1:57395480-57395502 GGCTTGTGGTAGTGGCTCAAGGG - Intronic
908708123 1:66982940-66982962 GACTAACCGTATAGGCTCAAGGG + Intronic
916732972 1:167582825-167582847 TTCTAAGGGTACTGGATCAAGGG - Intergenic
918630204 1:186708567-186708589 GTATACCTGTAGGGGCTCAAAGG - Intergenic
1063323073 10:5070417-5070439 GCCTGAGCGTAGTGGCTCAAGGG + Intronic
1066019372 10:31282584-31282606 GTGTAAGGGTAATGGCTGAATGG + Intergenic
1069039858 10:63684313-63684335 GACTAGCAGTAGTGGCTCAGTGG + Intergenic
1075216306 10:120539237-120539259 CTCTAACAGCAGTGGCTCTAGGG - Intronic
1088909174 11:114177769-114177791 GTCTAAGAGTAGTGACTCAGGGG - Intronic
1090245763 11:125214856-125214878 CTCTATCCATAGTGGCTCAAAGG + Intronic
1092645536 12:10567453-10567475 GTCCAACAGTAGTGGCACTAGGG + Intergenic
1093357087 12:18179038-18179060 GTCTAACCATAGGGGTTCAAGGG - Intronic
1095926858 12:47587059-47587081 GTGTTACGGTAGTGGCTCCAAGG - Intergenic
1096934605 12:55257632-55257654 GTCTATTGGTAGTGCCTCACCGG + Intergenic
1105916834 13:24924666-24924688 GACTAACGGTTGTGGCACAGGGG + Intergenic
1107993884 13:45842037-45842059 GTCTAACAAATGTGGCTCAAGGG - Intronic
1129887843 15:79051087-79051109 GTCTAAAGATAGTAGCTCAGGGG + Intronic
1137049374 16:35694825-35694847 GTCTAATGATAGAGGCTCATGGG - Intergenic
1148123011 17:45223259-45223281 GTCTGAGGGTGGGGGCTCAACGG + Intronic
1155694225 18:28665373-28665395 GTCTGCAGGCAGTGGCTCAAAGG - Intergenic
1156535878 18:37864033-37864055 GTCTTAGGGTACTGGCTAAATGG - Intergenic
1157546367 18:48549452-48549474 GTCTAAAGGTAGGAGCTCTAGGG + Intronic
925123185 2:1435385-1435407 GTCCAACGGGAATGGCTCTATGG - Intronic
942457854 2:176150232-176150254 GTCGAACGGTGGTGGCTCAGAGG + Intergenic
947163135 2:227234678-227234700 ATCTAACTGCAGAGGCTCAATGG + Intronic
1169973502 20:11297022-11297044 GTCTAAAGGTGGTGATTCAAGGG + Intergenic
1173882230 20:46424172-46424194 GTCTAACTGTAGTTGCTGCAAGG + Intronic
952934591 3:38386290-38386312 GGCAAACAGAAGTGGCTCAAGGG - Intronic
971359354 4:25922582-25922604 GGCTAACAGGAGTGGCTGAAAGG - Intronic
975871809 4:78787460-78787482 GTCTAACGGTAGTGGCTCAAGGG - Intronic
987362564 5:17120407-17120429 GTGTAACCGTTGTGGCTCACTGG + Intronic
993317292 5:86427131-86427153 GTCTGATGGTGGTGGCACAAGGG - Intergenic
1011622297 6:89254297-89254319 CTCTAATGGGTGTGGCTCAAAGG - Intergenic
1012630085 6:101455111-101455133 GTATAAGGGTAGTGGGTCATGGG + Intronic
1020415967 7:7946092-7946114 CTCTAACGGGACTGGCTCATGGG - Intronic
1034475963 7:151282168-151282190 GCCTACCGGTAGTGACTCAACGG - Intergenic
1034733465 7:153408659-153408681 GTCTAACAACAGTGGCACAAAGG - Intergenic
1042706042 8:71666353-71666375 GTCTAACGGTTGTTGCCAAATGG - Intergenic
1044212134 8:89562306-89562328 GTCTAACAGAAATGCCTCAAGGG - Intergenic