ID: 975874263

View in Genome Browser
Species Human (GRCh38)
Location 4:78817547-78817569
Sequence CAGAGTGGTGTACCTAGCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 101}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975874263_975874267 6 Left 975874263 4:78817547-78817569 CCCATGCTAGGTACACCACTCTG 0: 1
1: 0
2: 0
3: 4
4: 101
Right 975874267 4:78817576-78817598 CAGCCCTATGTTCACCAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975874263 Original CRISPR CAGAGTGGTGTACCTAGCAT GGG (reversed) Intronic
903327954 1:22582082-22582104 CAGAGTGGGGTACCTTTCCTGGG + Intronic
904048548 1:27623960-27623982 CAGGGTGGTGCACCTGGCAGGGG - Intronic
907671086 1:56475521-56475543 GAAAGTGGTGGGCCTAGCATTGG - Intergenic
912251929 1:108020600-108020622 CAGAGTGGTGTCCACAGAATGGG + Intergenic
915079140 1:153339423-153339445 CAGAATCGTGTACCAAGCAATGG + Intronic
919684265 1:200467541-200467563 AATAGTGGTGTACATAGCAAGGG + Intergenic
922876073 1:228940741-228940763 CAGAGTGCTGTCCCCAGCAAGGG - Intergenic
1063273921 10:4542798-4542820 CAGAGTGGTGTGCAAAGCAGAGG - Intergenic
1064506644 10:16038144-16038166 CAGAGTTGTGTAACTGACATTGG + Intergenic
1071364380 10:84883736-84883758 CTGAGTGGTGTCCATAGAATGGG + Intergenic
1071869842 10:89781596-89781618 CAGAGTCCTGTAGCTGGCATTGG + Intergenic
1071937787 10:90550065-90550087 CAGAGTGGTGTCCACAGGATGGG - Intergenic
1072026412 10:91463928-91463950 CAGAGAAGTGTACCTAGGAATGG - Intronic
1073672131 10:105603654-105603676 AAGAGGAGAGTACCTAGCATTGG + Intergenic
1082928448 11:58576139-58576161 CAGAGTGGGGTACCTACACTTGG - Intronic
1084079119 11:66807668-66807690 CAGAGAGCTGAGCCTAGCATTGG + Intronic
1088265520 11:107984363-107984385 CTGAGTGGTGTCCATAGAATGGG - Intergenic
1100313750 12:93423553-93423575 CAGCCTGGTGTACCTAGCGTGGG + Intronic
1110692169 13:78443476-78443498 CAATGTTGTGTACCTAGGATTGG - Intergenic
1111886576 13:94028985-94029007 CAGAGTGGTGAAAATAGCAGTGG + Intronic
1113319600 13:109220911-109220933 CTGAGTGGTGTCCATAGAATGGG + Intergenic
1114022883 14:18496812-18496834 CAGAGTGTTGTCCCTCACATAGG + Intergenic
1116906913 14:50413055-50413077 CATATTGGTGGACTTAGCATGGG - Intronic
1117064694 14:52000316-52000338 CTGAGTGGCCTATCTAGCATCGG - Intronic
1117881488 14:60317258-60317280 CTTAGTGTGGTACCTAGCATGGG - Intergenic
1119521718 14:75291139-75291161 CACAGAAGTGTACCAAGCATGGG + Intergenic
1122294753 14:100699114-100699136 CAGAGGTGCCTACCTAGCATCGG + Intergenic
1130772836 15:86942170-86942192 CACAGTGGTGTAACCAGAATAGG + Intronic
1139231145 16:65283607-65283629 CTCAGTGTTGTACTTAGCATAGG - Intergenic
1140613246 16:76626664-76626686 CAGATTGGTGAACCTGCCATTGG - Intronic
1141711947 16:85704909-85704931 CAGAGTGTTGAACCCAGCGTGGG + Intronic
1143794455 17:9325514-9325536 CAGAGTGTTGAATCAAGCATGGG - Intronic
1144178925 17:12733965-12733987 CTGAGTAGTTTACCTAGCAGTGG - Intronic
1151880001 17:76889125-76889147 CAGCTCGGTGTACCTGGCATGGG - Intronic
1156315993 18:35969264-35969286 AAGACTAGTTTACCTAGCATGGG + Intergenic
1156486993 18:37472666-37472688 CAGAGTGGTGGAGCTGGGATTGG + Intronic
1157936085 18:51874415-51874437 CAGGGTGGAGTACCCAGCAATGG + Intergenic
1160047752 18:75402928-75402950 CAGAATGGTATATCTAGCAAAGG + Intergenic
1162072564 19:8163076-8163098 CATAGTGAGGTACCTAGAATTGG + Intronic
1164158335 19:22610126-22610148 CAGAGTGTTGTCCCCAGCTTAGG - Intergenic
1165402880 19:35613044-35613066 CAGAGTGAGGTCCCTAGCACTGG + Intronic
1166153407 19:40891937-40891959 CTGACTGGAGTACCAAGCATAGG - Intronic
1166175023 19:41061704-41061726 CTGATTGGAGTACCAAGCATAGG + Intergenic
925625472 2:5838670-5838692 CAGAGTAGTGTCCCTAGGAATGG - Intergenic
927218909 2:20688492-20688514 CAGAGTGGTTTTCCTGACATAGG - Intronic
928924756 2:36566065-36566087 CACAGTTGTGTCCCTGGCATGGG - Intronic
929091451 2:38221660-38221682 CAGAGTTCTGTACCAAGCAGTGG - Intergenic
934024094 2:87985096-87985118 CAGAGTGGTGTCCTCAGTATTGG - Intergenic
940625248 2:156167193-156167215 CACAGTTTTGGACCTAGCATAGG + Intergenic
945851547 2:215014271-215014293 GAGAGTGCTGTAGGTAGCATTGG + Intronic
948213940 2:236215062-236215084 CTGAGTGGTGTAAATAGCAAAGG + Intronic
1171500650 20:25590410-25590432 CACACTGATGTAACTAGCATAGG + Intergenic
1180446986 22:15423768-15423790 CAGAGTGTTGTCCCTCACATAGG + Intergenic
1182863768 22:33584310-33584332 GACAATGATGTACCTAGCATGGG + Intronic
1182916872 22:34041625-34041647 CAGAGTGGTGTTCCTGGGCTGGG - Intergenic
949445711 3:4131818-4131840 CTGAGTGGTGTCCCCAGAATGGG - Intronic
951225310 3:20113953-20113975 CAGAGTGGTGAAGCTATCAGTGG - Intronic
953831243 3:46299155-46299177 CTGGCTGGTGTTCCTAGCATAGG - Intergenic
960555232 3:119020970-119020992 CACAGTGGTGTATATAGCATAGG + Intronic
961152902 3:124654673-124654695 CAGAGTAGTTTACCAAGCAGTGG + Intronic
961817403 3:129558364-129558386 CAGAGTGGGGTGCCGACCATGGG - Intronic
962251742 3:133840089-133840111 CTGAGTGGTGTCCCCACCATGGG + Intronic
964516867 3:157520127-157520149 CAGAGAGGTGAACCTGGCTTTGG - Intronic
965940175 3:174169678-174169700 CAGAGTGGGGCACCCAGCAATGG + Intronic
968080571 3:195843607-195843629 CAGGGTGGTCTGCCTAGCACGGG + Intergenic
970949666 4:21739665-21739687 CATAGTGGTGTGGGTAGCATTGG - Intronic
975874263 4:78817547-78817569 CAGAGTGGTGTACCTAGCATGGG - Intronic
977032737 4:91907197-91907219 CAGGATGGTGTTGCTAGCATAGG - Intergenic
977756590 4:100678844-100678866 CAGAGTGATGTCACTAGCAGTGG + Intronic
980864287 4:138536290-138536312 CAGAGTGGTGTATCCAGGAAAGG - Intergenic
981216630 4:142177119-142177141 CAGAGTTGTGTAGCAGGCATCGG + Intronic
981381996 4:144083925-144083947 CTAAGTGGTGAACCTAGCTTAGG + Intergenic
981937685 4:150252816-150252838 CAGAGTTGTGTAGGTAACATGGG - Intronic
982034545 4:151332596-151332618 CAGAGGGGTGGACCCAGGATTGG - Intergenic
982812297 4:159841075-159841097 CAGAGTGGTGTAACGAACTTTGG - Intergenic
993132512 5:83917142-83917164 TAGTGTGGGGTTCCTAGCATGGG - Intergenic
993499780 5:88652259-88652281 CAAAGTGCTGCACCAAGCATGGG - Intergenic
993856138 5:93077888-93077910 AAGAGTGGTGTACCTTATATTGG + Intergenic
994918196 5:106006090-106006112 CAGAGTGGAGTTCCCAGCACTGG + Intergenic
996898754 5:128519326-128519348 CAGAATGGTGGACGTTGCATCGG - Exonic
996926531 5:128833491-128833513 AAAAGTGCTGTACCTAGCACTGG - Intronic
997425411 5:133799528-133799550 CAGAGCCCTGTACCTAGCGTGGG - Intergenic
1001597967 5:172910261-172910283 CAGAGTGGTGTGCGTGGCAGGGG + Intronic
1003879896 6:10470642-10470664 CACAGTGGTGGACCTAGTAGAGG - Intergenic
1006796740 6:36737012-36737034 CTGCGTGGTGAACGTAGCATTGG - Intergenic
1011319259 6:86072078-86072100 CAGTGTGGTTTATCTAGAATTGG - Intergenic
1015406176 6:132839094-132839116 CTTAGTGTTGTACCTAGCAAAGG + Intergenic
1019064143 6:169281899-169281921 CAGAGTGGCGTACTTAGGATTGG + Intergenic
1021952703 7:25790732-25790754 CAGAGTAGTTGACCTGGCATGGG - Intergenic
1023869426 7:44255090-44255112 CAGAGTGGTGGCCCTCGCACAGG + Intronic
1032477436 7:132221930-132221952 CAGACTAGTGTATCTAGCAAAGG + Intronic
1035558703 8:588703-588725 CTGATTGGTGTACCTGGGATGGG - Intergenic
1050475660 9:6038106-6038128 CAGAGTGGTATAACAAACATTGG - Intergenic
1055903837 9:81270432-81270454 CTGAGTGGTGTCCATAGAATGGG + Intergenic
1058999671 9:110335624-110335646 GTGAGTGGTGTAGCTGGCATTGG + Intronic
1188314474 X:28656683-28656705 TAGTGTTGTGTACCTAGCATTGG + Intronic
1190002668 X:46704684-46704706 CGGAGTGGAGTATCTAGAATAGG + Intronic
1193509465 X:82382296-82382318 CGGAGTGGCGTACATAGCACAGG + Intergenic
1195247307 X:103006043-103006065 CAGAGTGGTGTGGCGAGCAGGGG - Intergenic
1198782944 X:140257053-140257075 CTGAGTGGTGTCCATAGAATGGG + Intergenic
1198845855 X:140909699-140909721 CTGACTGGTTGACCTAGCATTGG - Intergenic
1200193212 X:154230088-154230110 CAGAGTGGCCAACCTAGCCTAGG + Intronic
1200198967 X:154267892-154267914 CAGAGTGGCCAACCTAGCCTAGG + Intronic
1202244048 Y:22798022-22798044 CAGTGTGGTGTTCCCAACATGGG + Intergenic
1202397036 Y:24431772-24431794 CAGTGTGGTGTTCCCAACATGGG + Intergenic
1202473747 Y:25238320-25238342 CAGTGTGGTGTTCCCAACATGGG - Intergenic