ID: 975874839

View in Genome Browser
Species Human (GRCh38)
Location 4:78824405-78824427
Sequence CAGAGTTACAACTTACATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1319
Summary {0: 1, 1: 1, 2: 14, 3: 322, 4: 981}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975874836_975874839 9 Left 975874836 4:78824373-78824395 CCTCACAATCATGGCAGAAGGTG 0: 808
1: 1460
2: 3850
3: 4215
4: 4735
Right 975874839 4:78824405-78824427 CAGAGTTACAACTTACATGGTGG 0: 1
1: 1
2: 14
3: 322
4: 981
975874833_975874839 26 Left 975874833 4:78824356-78824378 CCATGTGGCTGGGGAGGCCTCAC 0: 590
1: 1821
2: 4838
3: 6940
4: 5923
Right 975874839 4:78824405-78824427 CAGAGTTACAACTTACATGGTGG 0: 1
1: 1
2: 14
3: 322
4: 981

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975874839 Original CRISPR CAGAGTTACAACTTACATGG TGG Intronic
900831422 1:4968485-4968507 CAAAGGCACACCTTACATGGTGG - Intergenic
900842069 1:5059842-5059864 CAAAGTCACATCTTACATGGTGG + Intergenic
900901403 1:5518869-5518891 CAAAGGCACATCTTACATGGTGG + Intergenic
901320477 1:8337169-8337191 CAAAGGCACATCTTACATGGTGG + Intronic
901440925 1:9277840-9277862 GAGAGGCACATCTTACATGGTGG + Intergenic
902065063 1:13678717-13678739 CAAAGTCACGTCTTACATGGTGG + Intergenic
902172289 1:14621760-14621782 CAAAGTCACATCTTACATGGCGG - Intronic
902665760 1:17936598-17936620 CAAAGGCACATCTTACATGGTGG - Intergenic
902710512 1:18236303-18236325 CAAAGTCACATCTTACATGGTGG - Intronic
903001718 1:20270901-20270923 CAAAGGCACATCTTACATGGTGG - Intergenic
903452756 1:23465802-23465824 CAGAGTTACAATTTAAATCCAGG + Intronic
904431544 1:30467756-30467778 CAGAGTCACGTCTTACATGGCGG - Intergenic
905755560 1:40506300-40506322 CAAAGTCACCTCTTACATGGTGG - Intergenic
905948212 1:41921469-41921491 CAGAGGCACATCTTACATGGTGG - Intronic
907280026 1:53341343-53341365 CAAAGGCACATCTTACATGGTGG - Intergenic
907562703 1:55405532-55405554 CAAAGTCACATCTTACATGGTGG + Intergenic
907660556 1:56388822-56388844 CAAAGTCACATCTTACATGGTGG + Intergenic
907844459 1:58191098-58191120 CAGAAATACAAGATACATGGAGG + Intronic
908290712 1:62664417-62664439 CAGAGGGACATCTTACATGGTGG - Intronic
908568561 1:65384571-65384593 CAAAGGCACATCTTACATGGTGG + Intronic
908655732 1:66386116-66386138 CAGACTTGCAACTGACATTGTGG + Intergenic
908770886 1:67594602-67594624 CAAAGACACATCTTACATGGTGG + Intergenic
908866386 1:68553533-68553555 CAAAGTCACATCTTACATGGTGG - Intergenic
909023377 1:70456842-70456864 TAAAGTCACATCTTACATGGTGG + Intergenic
909036558 1:70600505-70600527 CAGACTGACACCTTACATGGCGG - Intergenic
909240995 1:73212979-73213001 CAAAGGCACATCTTACATGGTGG + Intergenic
909269047 1:73600057-73600079 CAAAGGCACATCTTACATGGTGG + Intergenic
909328706 1:74386101-74386123 CAAAGTCACATCTTATATGGTGG - Intronic
909357626 1:74727335-74727357 CAAAGGCACAACTTGCATGGTGG + Intronic
909439694 1:75684076-75684098 CAAAGGTACATCTTACATGGTGG + Intergenic
909457648 1:75868772-75868794 CAAAGTTACATCTTACATGCCGG - Intronic
909574692 1:77160184-77160206 CAAAGGCACATCTTACATGGTGG - Intronic
909615875 1:77607197-77607219 CAAAGTCACGTCTTACATGGGGG + Intronic
909795891 1:79735438-79735460 CAAAGTCACATCTTACATGGTGG + Intergenic
909834374 1:80234692-80234714 AAGAGGCACACCTTACATGGTGG - Intergenic
910279040 1:85478464-85478486 CAAAGTTATATCTTACATGATGG + Intronic
910624637 1:89293265-89293287 CACAGGCACATCTTACATGGCGG + Intergenic
910661815 1:89681588-89681610 CAAAGGCACATCTTACATGGTGG + Intronic
910977305 1:92920359-92920381 CAAAGTCACATCTTACATGGTGG - Intronic
911275743 1:95855085-95855107 CAAAGTCACGTCTTACATGGTGG + Intergenic
911438803 1:97898840-97898862 CAAAGGCACATCTTACATGGTGG - Intronic
911792781 1:102039698-102039720 CAGAGTTACAATCTACGTGTTGG - Intergenic
911926039 1:103834254-103834276 CAAAGTCACATCTAACATGGTGG - Intergenic
911991558 1:104704638-104704660 CAAAGTCACCTCTTACATGGCGG + Intergenic
912607176 1:111003131-111003153 CAAAGTCACATCTTACATGGTGG - Intergenic
912870658 1:113302120-113302142 CAGAGTTAACACTTGCATGAGGG - Intergenic
913320366 1:117583694-117583716 CAAAGTCACATCTTACATGGTGG + Intergenic
914395104 1:147258707-147258729 CAGAGGTTCACCTTACAAGGAGG - Intronic
915989406 1:160498471-160498493 CAAAGTCACGTCTTACATGGTGG + Intronic
916309315 1:163377038-163377060 CAAAGTCACAACTTACATGGCGG - Intergenic
916467973 1:165091518-165091540 CAAAGTGACATCTTATATGGTGG - Intergenic
916970775 1:170012811-170012833 CAAAATTACATCTTACATGGTGG + Intronic
916989186 1:170224098-170224120 AAAAGTCACATCTTACATGGTGG + Intergenic
917221076 1:172728872-172728894 CAAAGGCACATCTTACATGGCGG + Intergenic
918139961 1:181711809-181711831 CAGAGTGACAGCTGTCATGGGGG + Intronic
918389192 1:184040109-184040131 CAAAGACACACCTTACATGGCGG - Intergenic
918548102 1:185708138-185708160 CAGACTGACACCTCACATGGCGG + Intergenic
918888434 1:190229348-190229370 CAAAGTCACATCTTATATGGGGG - Intronic
918935386 1:190914839-190914861 CAAAGGCACATCTTACATGGTGG - Intergenic
918976079 1:191488241-191488263 CAAAGTCACATCTTATATGGTGG - Intergenic
919021867 1:192115999-192116021 CAAAGGCACATCTTACATGGTGG - Intergenic
919141940 1:193583458-193583480 CAAAGTCACGTCTTACATGGTGG + Intergenic
919375956 1:196795298-196795320 CAAAGGTACATCTTACATGGTGG - Intronic
919385662 1:196920185-196920207 CAAAGGTACATCTTACATGGTGG - Intronic
920274867 1:204797092-204797114 CAAAGGCACATCTTACATGGTGG - Intergenic
920452039 1:206066625-206066647 AAGAGTTACAACCTACAGGCAGG + Intronic
921429033 1:215041961-215041983 CAAAGTCACGTCTTACATGGTGG + Intronic
921894045 1:220380406-220380428 CAAAGGCACATCTTACATGGTGG - Intergenic
922074341 1:222227988-222228010 CAAAGTCACATCTTACATGGTGG + Intergenic
922168937 1:223139008-223139030 CAAAGTCACATCTTACATGGCGG - Intronic
922370841 1:224909386-224909408 CTCAGGTACATCTTACATGGTGG + Intronic
922420052 1:225453566-225453588 CAAAGTCACGTCTTACATGGTGG + Intergenic
922963540 1:229668154-229668176 AAAAGTCACATCTTACATGGTGG + Intergenic
923368573 1:233287539-233287561 CAAAGTCACGTCTTACATGGTGG - Intronic
923384249 1:233450819-233450841 CAAAGTCACATCTTACATGGCGG + Intergenic
923836504 1:237616849-237616871 CAAAGTCACATCTTACATGGTGG + Intronic
923879956 1:238092787-238092809 CAAAATGACATCTTACATGGTGG + Intergenic
923892002 1:238226489-238226511 GAAAGTTACATTTTACATGGCGG + Intergenic
923915604 1:238500293-238500315 GAAAGTCACATCTTACATGGTGG - Intergenic
924036219 1:239941133-239941155 CAAAGTCACATCTTACATGGCGG - Intergenic
924104544 1:240637134-240637156 AAAAGTCACATCTTACATGGTGG - Intergenic
924177988 1:241412210-241412232 CAAAGTCACATCTTAAATGGTGG - Intergenic
924272845 1:242351536-242351558 CAAAGGCACATCTTACATGGGGG - Intronic
924277957 1:242407199-242407221 CAAAGTCACGTCTTACATGGTGG - Intronic
924545786 1:245025868-245025890 CAGAGGCACATCTTACATGGCGG - Intronic
924742989 1:246808088-246808110 CAGAGTTTCAACTTTCACAGTGG + Intergenic
1062859400 10:798485-798507 CAAAGGCACATCTTACATGGTGG + Intergenic
1062945035 10:1454119-1454141 CAAAGTCACATCTTACATGGCGG + Intronic
1063353765 10:5379397-5379419 CAAAGGCACATCTTACATGGTGG + Intergenic
1063542697 10:6950400-6950422 CAAAGTCATATCTTACATGGTGG + Intergenic
1063549787 10:7020007-7020029 CAAAGTCACATCTTACATGGTGG + Intergenic
1063582601 10:7322246-7322268 CAAAGGCACATCTTACATGGTGG - Intronic
1063600966 10:7481082-7481104 CTGATTTATAAATTACATGGAGG + Intergenic
1063604465 10:7509975-7509997 CAAAGTCACATCTTACATGGTGG - Intergenic
1063804250 10:9619943-9619965 CAAAGTCACATCTTACATGGTGG - Intergenic
1063806798 10:9653904-9653926 CAAAGGCACATCTTACATGGAGG - Intergenic
1063892348 10:10643413-10643435 CAAAGTCACGTCTTACATGGTGG - Intergenic
1063927857 10:10998055-10998077 CAAAGTCACATCTTACATGGTGG - Intergenic
1063940545 10:11124010-11124032 CAAAGTCACGTCTTACATGGTGG + Intronic
1064264860 10:13817667-13817689 CAAAGGCACATCTTACATGGCGG - Intronic
1064293329 10:14054874-14054896 CAAAGTCACATCTTACATGGTGG - Intronic
1064448384 10:15418190-15418212 AAAAGGTACATCTTACATGGTGG - Intergenic
1064508857 10:16067059-16067081 CAAAGTCACATCTTACATGGTGG + Intergenic
1064534119 10:16341312-16341334 CAAAGGGACATCTTACATGGCGG + Intergenic
1064564020 10:16621638-16621660 CAAAGGCACATCTTACATGGCGG + Intronic
1064569361 10:16676324-16676346 CAAAGGCACATCTTACATGGTGG + Intronic
1064580437 10:16787701-16787723 CAAAGGGACATCTTACATGGGGG - Intronic
1064725260 10:18272709-18272731 CAAAGGGACATCTTACATGGCGG - Intronic
1064919787 10:20503995-20504017 CAAAGTCACATCTTACATGATGG - Intergenic
1064929970 10:20614159-20614181 CAAAGTGACATCTTACATGGTGG - Intergenic
1065084583 10:22162109-22162131 CAAAGTTACGTCTTACATGGCGG + Intergenic
1065311642 10:24422056-24422078 TAAAGTCACATCTTACATGGTGG + Intronic
1065373047 10:25009819-25009841 CAAAGTCACATCTTACATAGTGG - Intronic
1065373462 10:25013092-25013114 CAAAGTCACATCTTACATGGTGG - Intronic
1065386650 10:25140398-25140420 CAAAGTCACATCTTACATGGTGG - Intergenic
1065401684 10:25309798-25309820 CAAAGGCACATCTTACATGGTGG - Intronic
1066193948 10:33080495-33080517 CAAAGTCACATCTTGCATGGCGG - Intergenic
1066461889 10:35619584-35619606 CAAAGGCACATCTTACATGGTGG - Intergenic
1066556700 10:36622456-36622478 CAAAGTCACATCTTACATGGCGG + Intergenic
1066641645 10:37560014-37560036 CAAAGGCACATCTTACATGGTGG + Intergenic
1066711869 10:38245129-38245151 CAAAGGCACATCTTACATGGGGG + Intergenic
1067458411 10:46439947-46439969 CAAAGTCACATCCTACATGGTGG + Intergenic
1067628785 10:47944687-47944709 CAAAGTCACATCCTACATGGTGG - Intergenic
1068010179 10:51438881-51438903 CAGTTTTACAGATTACATGGTGG + Intronic
1068221906 10:54056441-54056463 CAAAGTCACACCTTACATGATGG + Intronic
1068331639 10:55578765-55578787 CAAAGTCACATCTAACATGGTGG + Intronic
1068452514 10:57211031-57211053 AAGAGGCACATCTTACATGGCGG + Intergenic
1068610392 10:59053671-59053693 CAAAGTTATGTCTTACATGGTGG + Intergenic
1068723475 10:60273836-60273858 CAAAGTCACATTTTACATGGTGG - Intronic
1068779784 10:60907074-60907096 CAAAGTCACATCTTACATGGTGG - Intronic
1068916977 10:62443329-62443351 CAGAGTGACAACAGACATTGAGG - Intronic
1071169606 10:82848862-82848884 CAAAGGCACATCTTACATGGCGG - Intronic
1071208044 10:83306627-83306649 GAGAGTAACTACTTACAAGGAGG - Intergenic
1071271311 10:84010112-84010134 CAAAGTCACATCTTACATGGTGG + Intergenic
1071671432 10:87612646-87612668 CAAAGGGACATCTTACATGGCGG - Intergenic
1072048521 10:91680981-91681003 CAGATTTCCAACATCCATGGTGG - Intergenic
1072377451 10:94832326-94832348 AAAAGTCACATCTTACATGGTGG + Intronic
1072769492 10:98125840-98125862 CAAAGTCACATCTTACATGGTGG + Intergenic
1072912008 10:99510682-99510704 CAAAGTCACATCTTGCATGGTGG + Intergenic
1073965033 10:108978883-108978905 CAAAGTCACGTCTTACATGGTGG - Intergenic
1073981857 10:109163256-109163278 CATAGTCACATCTTACATGGTGG + Intergenic
1074191139 10:111138802-111138824 CAGAGTTAGGACTTACCTTGGGG + Intergenic
1074369125 10:112885037-112885059 CAAAGTCACATCTTACATGGTGG - Intergenic
1074496933 10:113987536-113987558 GAAAGTCACATCTTACATGGCGG - Intergenic
1074576575 10:114675449-114675471 CAAAGTCACCTCTTACATGGAGG - Intronic
1074889627 10:117724596-117724618 CAAAGGCACATCTTACATGGTGG + Intergenic
1075094712 10:119463380-119463402 CAAAGGCACATCTTACATGGTGG - Intergenic
1075225178 10:120622367-120622389 GAAAGGTACATCTTACATGGTGG - Intergenic
1075270688 10:121047562-121047584 AAAAGTCACATCTTACATGGTGG - Intergenic
1075530408 10:123224473-123224495 AAAAGGTACATCTTACATGGTGG + Intergenic
1075627991 10:123977138-123977160 AAAAGTCACATCTTACATGGAGG - Intergenic
1075822681 10:125328243-125328265 CAAAGAGACATCTTACATGGCGG - Intergenic
1076274692 10:129187223-129187245 CAAAGGCACATCTTACATGGAGG + Intergenic
1076928905 10:133514273-133514295 CAAAGTCACATCTCACATGGTGG + Intergenic
1077768725 11:5191012-5191034 CAAAGTCACATCTGACATGGTGG + Intergenic
1078324389 11:10367845-10367867 CAAAGTCACATCTTACATGGCGG - Intronic
1078601948 11:12740595-12740617 AACAGGTACATCTTACATGGCGG + Intronic
1078719328 11:13870224-13870246 CAAAGTGACATCTTACATGGTGG + Intergenic
1078936408 11:15954896-15954918 CAAAGTCACATCTTGCATGGTGG - Intergenic
1079139503 11:17798603-17798625 CGGATTTAGAACTTACAAGGTGG + Intronic
1079176642 11:18148122-18148144 CAAAGGCACATCTTACATGGTGG + Intronic
1079484297 11:20918576-20918598 CAAAGTCACATCTTACATGGTGG + Intronic
1079669858 11:23155004-23155026 CAAAGTCACATTTTACATGGTGG - Intergenic
1079728961 11:23916411-23916433 CAGAGTCACATCTTACATGGTGG - Intergenic
1079736064 11:23998937-23998959 CAAAGGCACATCTTACATGGTGG + Intergenic
1079754776 11:24243541-24243563 CAAAGGCACATCTTACATGGTGG + Intergenic
1079844207 11:25444000-25444022 CAAAGTCACATCTTGCATGGTGG - Intergenic
1079874891 11:25844304-25844326 CAAAGTCACATCTTACATGGTGG - Intergenic
1079905905 11:26246841-26246863 CAAAGGCACATCTTACATGGAGG - Intergenic
1079945032 11:26731657-26731679 CAAAGTCACATCTTACATGGTGG - Intergenic
1079945340 11:26733964-26733986 CAAAGTCATATCTTACATGGTGG - Intergenic
1079971312 11:27039318-27039340 CAAAGGCACATCTTACATGGTGG - Intergenic
1080104203 11:28494776-28494798 CAAAGTCACATCTTACATGGTGG - Intergenic
1080104335 11:28496226-28496248 CAAAGTTATGTCTTACATGGTGG + Intergenic
1080136991 11:28866606-28866628 CAAAGGCACACCTTACATGGTGG + Intergenic
1080706483 11:34700061-34700083 CAGTGTTGCAACAAACATGGTGG + Intergenic
1080841300 11:35985752-35985774 CAAAGGCACATCTTACATGGTGG - Intronic
1080927031 11:36768311-36768333 CAGAGGCACATCTTTCATGGTGG + Intergenic
1081149640 11:39611220-39611242 CAGAGATATAATTTACATGGTGG + Intergenic
1081166957 11:39819223-39819245 CAAAGGCACATCTTACATGGTGG + Intergenic
1081234121 11:40625395-40625417 CAAAGGCACATCTTACATGGAGG + Intronic
1082088361 11:48068468-48068490 CAAAGTCACATCTTACATGGTGG - Intronic
1082906497 11:58312868-58312890 CAAAGGCACATCTTACATGGTGG + Intergenic
1082948106 11:58781519-58781541 CAAAGGCACATCTTACATGGTGG + Intergenic
1083154259 11:60813000-60813022 CAAAGTCACGTCTTACATGGTGG + Intergenic
1083251105 11:61467849-61467871 CAAAGTCACGTCTTACATGGTGG - Intronic
1083493082 11:63027463-63027485 CAAAGTCACATCTTACGTGGTGG + Intergenic
1084306131 11:68284775-68284797 CAAAGGCACATCTTACATGGCGG - Intergenic
1084440805 11:69171973-69171995 CAAAGTCACATCTTGCATGGCGG + Intergenic
1084491702 11:69482175-69482197 CAAAGGCACATCTTACATGGAGG + Intergenic
1084678837 11:70653290-70653312 CAGAGTTAAATATTACTTGGAGG - Intronic
1085251450 11:75146718-75146740 AAGAGTTACAGCCTACAAGGTGG - Intronic
1085788509 11:79475674-79475696 GAAAGTCACATCTTACATGGTGG + Intergenic
1085860354 11:80226046-80226068 CAAAGTCACATCGTACATGGTGG + Intergenic
1086199299 11:84181860-84181882 CAGAGTGCCAAAATACATGGGGG + Intronic
1086348261 11:85920094-85920116 CAAAGTCACATCATACATGGTGG + Intergenic
1086798809 11:91144758-91144780 CAGAGTCACATCTTACATGGTGG + Intergenic
1087286347 11:96268785-96268807 CAAAGTCACATCTTACATGGCGG - Intronic
1087462933 11:98467973-98467995 CAGAGTCAGAACTTATCTGGAGG - Intergenic
1087630973 11:100649653-100649675 CAAAGGCACATCTTACATGGTGG - Intergenic
1087838146 11:102895298-102895320 CAAAGTCACATCTTACATGGTGG + Intergenic
1088212395 11:107471434-107471456 AAAAGTCACATCTTACATGGAGG + Intergenic
1088317791 11:108525109-108525131 GAAAGTCACATCTTACATGGTGG - Intronic
1088726114 11:112636696-112636718 CAAAGGGACATCTTACATGGTGG - Intergenic
1089147653 11:116341680-116341702 CAAAGTCACATCTTACATGATGG - Intergenic
1089367129 11:117927750-117927772 CAGAGTTCCATCTTAAATAGGGG + Intronic
1089864989 11:121623980-121624002 CAAAGCCACATCTTACATGGCGG + Intronic
1090310748 11:125735575-125735597 AGGAGGTACATCTTACATGGTGG - Intergenic
1090696303 11:129246213-129246235 CTGTGTTACAACTGACATGAGGG - Intronic
1091144700 11:133267840-133267862 CAAAGTCACATCTTACATGGTGG - Intronic
1092312335 12:7371090-7371112 CAAAGTCACGTCTTACATGGTGG - Intronic
1092578197 12:9812977-9812999 AAGAGGTAAAACTTCCATGGGGG + Intergenic
1092665577 12:10792732-10792754 CAAAGGCACATCTTACATGGTGG + Intergenic
1092830227 12:12437278-12437300 CAAAGTCACATCTTACATGGCGG - Intronic
1092862259 12:12728732-12728754 CAGAGTCACAACTAACATATTGG - Intronic
1093190505 12:16069264-16069286 CAGAGGTACAACTGACCTGCTGG - Intergenic
1093277828 12:17151784-17151806 CAAAGTCACGTCTTACATGGTGG + Intergenic
1093296172 12:17394861-17394883 CAAAGGCACATCTTACATGGTGG + Intergenic
1093511530 12:19935122-19935144 CAAAGTTACGTCTTATATGGTGG - Intergenic
1093671649 12:21883419-21883441 CAAAGGCACATCTTACATGGTGG - Intronic
1093992058 12:25600996-25601018 CAGTGCTCCAACATACATGGGGG - Intronic
1094181681 12:27598293-27598315 CAAAGTCACATCTTACATGGTGG + Intronic
1094397476 12:30024091-30024113 CAAAGACACATCTTACATGGTGG + Intergenic
1094677771 12:32637701-32637723 AAGAGGCACATCTTACATGGTGG + Intronic
1094801053 12:34036402-34036424 CAAAGTCACATTTTACATGGTGG + Intergenic
1095114187 12:38332414-38332436 CAAAGTCACATTTTACATGGTGG + Intergenic
1095143933 12:38700863-38700885 CAAAGTTATGTCTTACATGGTGG - Intronic
1095343808 12:41125023-41125045 AAAAGTCACATCTTACATGGTGG - Intergenic
1095540243 12:43301306-43301328 CAAAGTCACATCTTACCTGGTGG - Intergenic
1095743118 12:45628361-45628383 TAGTGTTACATTTTACATGGTGG - Intergenic
1095793223 12:46189815-46189837 CAAAGTCACGTCTTACATGGTGG - Intronic
1095939938 12:47719624-47719646 CAAAGACACATCTTACATGGTGG - Intronic
1096174715 12:49506392-49506414 CAAAGTCACATCTTACATGGTGG + Intronic
1096666776 12:53171407-53171429 CAGATTTACAGCATACATGTTGG + Exonic
1096899915 12:54866236-54866258 CAAAGTCACATCTTACATCGTGG - Intergenic
1096913458 12:55007444-55007466 CAAAGGCACATCTTACATGGCGG - Intergenic
1097325896 12:58276605-58276627 CAAAGGCACATCTTACATGGTGG - Intergenic
1097723968 12:63053403-63053425 CAAAGTCACATCTTACATGGTGG - Intergenic
1098008091 12:66020622-66020644 CAAAGTTACATCTTAGGTGGCGG + Intergenic
1098149413 12:67530859-67530881 CAAAGTTACATCTTACATGGTGG - Intergenic
1098327477 12:69317413-69317435 CAAAGGCACATCTTACATGGTGG + Intergenic
1098544247 12:71693858-71693880 CAAAGTCACATCTTACATAGCGG - Intronic
1098607125 12:72404576-72404598 CAAAGAAACATCTTACATGGTGG + Intronic
1098648655 12:72938453-72938475 CAAAGTCACCCCTTACATGGAGG + Intergenic
1098661571 12:73101038-73101060 CAGAGCTACAAGTCACCTGGGGG - Intergenic
1098833161 12:75388209-75388231 CAAAGGGACATCTTACATGGTGG - Intronic
1098944161 12:76572276-76572298 CAAAGTCACATCTTACATGGTGG + Intergenic
1099011330 12:77294949-77294971 CAAAGTCACATCTTACATAGTGG + Intergenic
1099073990 12:78082137-78082159 CAAAGCCACATCTTACATGGTGG - Intronic
1099494558 12:83330159-83330181 CAAAGGCACATCTTACATGGTGG - Intergenic
1100043726 12:90352922-90352944 AACAGTCACATCTTACATGGTGG - Intergenic
1100182442 12:92100200-92100222 CAGGGGCACATCTTACATGGTGG + Intronic
1100293642 12:93239974-93239996 CAAAGGCACATCTTACATGGTGG + Intergenic
1100348188 12:93753131-93753153 CAAAGTCACGTCTTACATGGTGG + Intronic
1100657826 12:96666532-96666554 CAAAGGCACATCTTACATGGCGG + Intronic
1100898935 12:99216138-99216160 CAAAGGCACATCTTACATGGTGG - Intronic
1100946253 12:99787344-99787366 CAAAGTCACATCTTACATGGTGG - Intronic
1101071705 12:101082259-101082281 CAAAGACACATCTTACATGGTGG - Intronic
1101276290 12:103205367-103205389 GAAAGTCACATCTTACATGGTGG + Intergenic
1101423017 12:104564848-104564870 CAAAGGCACATCTTACATGGTGG + Intronic
1101449884 12:104766516-104766538 CAAAGGGACATCTTACATGGTGG - Intergenic
1101541414 12:105669010-105669032 CAAAGGGACATCTTACATGGTGG + Intergenic
1101676706 12:106923754-106923776 CAAAGGCACATCTTACATGGCGG + Intergenic
1102775603 12:115516006-115516028 CAAAGGCACATCTTACATGGTGG + Intergenic
1103040860 12:117694373-117694395 CAAAGTCACATCTTACATGGTGG - Intronic
1103305501 12:119960817-119960839 CAAAGTCACGTCTTACATGGTGG - Intergenic
1103472273 12:121191399-121191421 CAAAGCCACATCTTACATGGTGG - Intergenic
1103881460 12:124169260-124169282 CAAAGTGACATCTTACATGGCGG - Intronic
1103967378 12:124648345-124648367 CATAGTTCCCACTTACAAGGGGG - Intergenic
1104068135 12:125322273-125322295 CAAAGGCACATCTTACATGGCGG - Intronic
1104079700 12:125419401-125419423 CAAAGTCACATCTTACATGGTGG + Intronic
1104079977 12:125421382-125421404 CAAAGTCACATCTTACATGGTGG + Intronic
1104119996 12:125789835-125789857 CAAAGTCACATCTTACATGGTGG - Intergenic
1104140064 12:125979359-125979381 AAAAGTCACATCTTACATGGTGG + Intergenic
1104206541 12:126643936-126643958 CAAAGTCACATCTCACATGGTGG + Intergenic
1104212313 12:126700776-126700798 CAAAGACACATCTTACATGGTGG - Intergenic
1104262696 12:127199033-127199055 CAAAGGTACATCTTACGTGGCGG + Intergenic
1104393026 12:128407250-128407272 CAAAGGCACATCTTACATGGTGG - Intronic
1104411090 12:128558455-128558477 CAAAGTCACATCTTACATGGTGG - Intronic
1105235635 13:18549806-18549828 CAAAGTCACATCTTACATGGAGG - Intergenic
1105576346 13:21656626-21656648 CAAAGGCACATCTTACATGGCGG + Intergenic
1105694277 13:22872543-22872565 CAAAGGCACATCTTACATGGTGG - Intergenic
1105755990 13:23465047-23465069 CAAAGTCACATCTTACATGGCGG - Intergenic
1106354254 13:28964595-28964617 CAGAGTTGCAAGTGACATTGGGG + Intronic
1106788714 13:33132433-33132455 AAAAGGTACATCTTACATGGCGG - Intronic
1106929704 13:34651146-34651168 CAAAGTTACGTCTTACCTGGTGG - Intergenic
1107188513 13:37550816-37550838 CAAAGGCACATCTTACATGGTGG - Intergenic
1107213558 13:37888271-37888293 CAAAGGGACATCTTACATGGTGG - Intergenic
1107310250 13:39069743-39069765 CAAAGAAACATCTTACATGGTGG - Intergenic
1107431232 13:40342294-40342316 CAAAGACACATCTTACATGGTGG + Intergenic
1107693834 13:42980467-42980489 CAAAGGCACATCTTACATGGTGG + Intronic
1107741583 13:43455846-43455868 CAAAGTCACATCTTACAGGGTGG - Intronic
1108179154 13:47823758-47823780 CAGAGGCATATCTTACATGGTGG - Intergenic
1108707195 13:53000340-53000362 CAAAGGCACATCTTACATGGTGG - Intergenic
1108788959 13:53943135-53943157 GAAAGCCACAACTTACATGGTGG + Intergenic
1108981230 13:56517918-56517940 CAAAGTCACGTCTTACATGGTGG + Intergenic
1109071439 13:57773885-57773907 CAAAGTAACATCTTACACGGTGG - Intergenic
1109348200 13:61143265-61143287 CAAAGGAACATCTTACATGGTGG - Intergenic
1109737477 13:66505607-66505629 CAAAGTCACATCTTACATGGTGG + Intronic
1109883332 13:68510800-68510822 CAAAGTCACATCTCACATGGTGG - Intergenic
1109905336 13:68831937-68831959 CAAAGGCACATCTTACATGGCGG - Intergenic
1109960564 13:69623621-69623643 CAAAGGCACATCTTACATGGTGG + Intergenic
1110028408 13:70571741-70571763 CAAAGTCACGTCTTACATGGTGG - Intergenic
1110075120 13:71230730-71230752 CAAAGGTACATCTTACATGGTGG + Intergenic
1110520029 13:76464780-76464802 CAAAGTTACATCTTACATGGTGG - Intergenic
1110616615 13:77548770-77548792 CAAAGTCACATCTTACATGAGGG - Intronic
1110793032 13:79606370-79606392 CAAAGGCACATCTTACATGGTGG + Intergenic
1110929075 13:81193476-81193498 CAAAGTCACATCTCACATGGTGG + Intergenic
1111173807 13:84565721-84565743 CAGAATTTCAACTTCCTTGGAGG + Intergenic
1111198236 13:84900972-84900994 AAAAGTCACATCTTACATGGTGG + Intergenic
1111199403 13:84914307-84914329 CAAAGGCACATCTTACATGGTGG + Intergenic
1111268306 13:85849332-85849354 CAAAGTCACATCTTACATGAAGG + Intergenic
1111288607 13:86130565-86130587 CAAAATTACATCTTAGATGGTGG - Intergenic
1111310304 13:86475585-86475607 CAAAGGCACATCTTACATGGTGG + Intergenic
1111370709 13:87313094-87313116 CAAAGGCACATCTTACATGGTGG + Intergenic
1111435116 13:88196531-88196553 CAAAGGCACATCTTACATGGTGG - Intergenic
1111689938 13:91550885-91550907 CAAAGTCACGTCTTACATGGTGG - Intronic
1111885635 13:94017411-94017433 CAACGGTACATCTTACATGGTGG + Intronic
1112108394 13:96267148-96267170 CAAAGGCACATCTTACATGGTGG - Intronic
1112117009 13:96366936-96366958 CAAAGGCACATCTTACATGGTGG - Intronic
1112163175 13:96890071-96890093 CAAAGGCACATCTTACATGGCGG + Intergenic
1112268961 13:97950900-97950922 AAAAGATACATCTTACATGGTGG - Intergenic
1112301060 13:98230938-98230960 CAAAGGCACATCTTACATGGCGG + Intronic
1112598553 13:100832351-100832373 CAAAGGCACATCTTACATGGTGG + Intergenic
1112744069 13:102507689-102507711 CAAAGACACATCTTACATGGTGG - Intergenic
1113333250 13:109352540-109352562 CAAAGCCACATCTTACATGGGGG - Intergenic
1113359719 13:109619143-109619165 CAAAGGCACATCTTACATGGAGG + Intergenic
1113395699 13:109945522-109945544 GAAAGTCACATCTTACATGGTGG - Intergenic
1113432093 13:110260221-110260243 CAAAGCCACATCTTACATGGCGG + Intronic
1113526156 13:110979325-110979347 CAAAGGCACATCTTACATGGTGG + Intergenic
1114397455 14:22379233-22379255 AAGAGTTTTAAATTACATGGGGG + Intergenic
1114586135 14:23815720-23815742 CAAAGTCACACCTTCCATGGTGG - Intergenic
1114804949 14:25824493-25824515 CAAAGTCATATCTTACATGGCGG + Intergenic
1114938100 14:27570473-27570495 TAAAGTCACATCTTACATGGTGG + Intergenic
1114975986 14:28100051-28100073 CAAAGGCACATCTTACATGGTGG - Intergenic
1115031691 14:28803537-28803559 CAAAGTCACATCTTACATGGTGG + Intronic
1115068247 14:29292046-29292068 AAGAGGTACATCTTACATGGTGG + Intergenic
1115079885 14:29437570-29437592 CAAAGAAACATCTTACATGGTGG - Intergenic
1116138508 14:40958666-40958688 CAAAGTCACATCTTACATGGTGG + Intergenic
1116198798 14:41763701-41763723 CAAAGGGACATCTTACATGGCGG - Intronic
1116296519 14:43118763-43118785 CAAAGTCACATCTTATATGGTGG + Intergenic
1116296792 14:43120782-43120804 TAGAGGCACATCTTACATGGTGG + Intergenic
1116715418 14:48419839-48419861 CAAAGTCACATCTTGCATGGTGG - Intergenic
1116738075 14:48719717-48719739 CAAAGTCACGTCTTACATGGTGG + Intergenic
1116740091 14:48743723-48743745 CAGAGTTACAAAGTAGATTGGGG - Intergenic
1117084256 14:52182634-52182656 CAAAGTTACATCTTACATAGCGG - Intergenic
1117106980 14:52407747-52407769 CAAAGTCACGTCTTACATGGTGG - Intergenic
1117366897 14:55038089-55038111 CAAAGTCACATCTTACATGGTGG + Intronic
1117571181 14:57050661-57050683 CAAAGTCACATCTTGCATGGCGG + Intergenic
1117758914 14:59005593-59005615 CAAAGTCACATCTTACATGGTGG + Intergenic
1118072672 14:62263080-62263102 CAAAGTCACATCTTACACGGTGG + Intergenic
1118129999 14:62952176-62952198 GAGAGTTTCAACTTAAATAGAGG - Intronic
1119050169 14:71359257-71359279 CAAAGTGACATCTTACATGGCGG - Intronic
1119838694 14:77774107-77774129 CAAAGTCACGTCTTACATGGTGG + Intergenic
1119854494 14:77889088-77889110 CAAAGGCACATCTTACATGGTGG - Intronic
1119880549 14:78096334-78096356 GAAAGTCACATCTTACATGGTGG + Intergenic
1119971847 14:78979769-78979791 CAAAGTCACGTCTTACATGGAGG + Intronic
1119994779 14:79241438-79241460 CAAAGGCACATCTTACATGGCGG + Intronic
1120044162 14:79788104-79788126 CAAAGGCACATCTTACATGGTGG + Intronic
1120096778 14:80397945-80397967 CAAAGGCACATCTTACATGGTGG - Intergenic
1120499090 14:85271659-85271681 CAAAGTCACGTCTTACATGGCGG + Intergenic
1120636868 14:86964125-86964147 GAAAGGTACATCTTACATGGTGG - Intergenic
1120719223 14:87872328-87872350 CAAAGTCACATCTTACATGGTGG + Intronic
1120822617 14:88926754-88926776 CAAAATCACATCTTACATGGTGG - Intergenic
1120831939 14:89005204-89005226 CAAAGTCACATCTTACATGGTGG + Intergenic
1120947711 14:90013476-90013498 CAAAGGCACATCTTACATGGCGG - Intronic
1120963766 14:90149448-90149470 CAAAGGCACATCTTACATGGTGG + Intronic
1121125565 14:91404507-91404529 CAGACTCCCAACTTACATGCAGG + Intronic
1121344434 14:93124991-93125013 CAAAGTCACTTCTTACATGGTGG + Intergenic
1121421905 14:93821901-93821923 CAAAGTCACATCTTATATGGCGG - Intergenic
1121499207 14:94420102-94420124 CAAAGTCACATCTTACATGGTGG - Intergenic
1121814457 14:96918413-96918435 CAAAGTCACGTCTTACATGGTGG - Intronic
1121965886 14:98305335-98305357 CAAAGGCACATCTTACATGGTGG - Intergenic
1121968136 14:98329418-98329440 CAAAGGCACATCTTACATGGTGG - Intergenic
1124029481 15:25996950-25996972 CAAAGTCACATCTTACATGGCGG + Intergenic
1124325525 15:28757887-28757909 CAAAGTCACATCTTACATGGTGG + Intergenic
1124433359 15:29626427-29626449 CAAAGTCACATCCTACATGGAGG - Intergenic
1124858145 15:33410889-33410911 CAAAGGCACATCTTACATGGCGG + Intronic
1125148963 15:36509101-36509123 CAAAGGTACATCTTACGTGGTGG - Intergenic
1125231638 15:37463377-37463399 CAAAGTCACTTCTTACATGGTGG + Intergenic
1126326049 15:47478871-47478893 CAAAGGCACATCTTACATGGAGG + Intronic
1126332044 15:47543431-47543453 CAAAGTCACATCTTACATGGTGG - Intronic
1126383390 15:48070411-48070433 CAAAGTCACATCTTACATGGTGG - Intergenic
1126514570 15:49520603-49520625 CAAAGGCACATCTTACATGGTGG + Intronic
1126707033 15:51415377-51415399 CAAAGGCACATCTTACATGGCGG + Intergenic
1127188642 15:56506650-56506672 AAAAGGTACATCTTACATGGTGG + Intergenic
1127654697 15:61045276-61045298 CAAAGTCACATCTTACATGGCGG - Intronic
1127853766 15:62938255-62938277 CAAAGTCACAACATACATGGTGG + Intergenic
1129914480 15:79256743-79256765 CAAAGGCACATCTTACATGGCGG + Intergenic
1129916679 15:79280246-79280268 GAAAGTCACATCTTACATGGTGG - Intergenic
1130215096 15:81960634-81960656 CAAAGGGACATCTTACATGGTGG - Intergenic
1130422160 15:83758299-83758321 CAAAGGGACATCTTACATGGTGG + Intronic
1131407782 15:92180502-92180524 CAAAGTCACATCTTACATGGTGG + Intergenic
1131630127 15:94167396-94167418 CAAAGTCAGATCTTACATGGTGG - Intergenic
1131659867 15:94502325-94502347 CAGGGTCACATCTTACATGGTGG - Intergenic
1131807562 15:96138295-96138317 CAAAGTCACATCTTACATGGCGG + Intergenic
1132209585 15:100010108-100010130 CAAAGGCACATCTTACATGGTGG - Intronic
1132239110 15:100244091-100244113 AAAAGTCACATCTTACATGGTGG + Intronic
1132949211 16:2551160-2551182 CAGATTTACAGCTTACCTGTGGG - Intronic
1132965377 16:2650968-2650990 CAGATTTACAGCTTACCTGTGGG + Intergenic
1133696574 16:8269226-8269248 CAAAGTCACATCTTATATGGTGG + Intergenic
1133731875 16:8585082-8585104 CAAAGTCACGTCTTACATGGCGG + Intronic
1133835325 16:9362568-9362590 CAAAGTCACATCTTACATGGTGG + Intergenic
1133968259 16:10547328-10547350 CAAAGCCACATCTTACATGGTGG - Intronic
1134232857 16:12442502-12442524 CAGAGTTGCATCTGAGATGGAGG - Intronic
1134285437 16:12857629-12857651 CAAAGTCACGTCTTACATGGTGG + Intergenic
1134294332 16:12932073-12932095 CAAAGGTACATCTTACATGGTGG - Intronic
1134453053 16:14375077-14375099 CAAAGTCACATCTTACATGGTGG - Intergenic
1134569270 16:15277705-15277727 CAAAGTCACGTCTTACATGGTGG + Intergenic
1134784174 16:16925832-16925854 AAGAGACACATCTTACATGGTGG - Intergenic
1134934332 16:18233633-18233655 CAAAGTCACGTCTTACATGGTGG + Intergenic
1135079406 16:19421452-19421474 CAAAGGCACATCTTACATGGCGG - Intronic
1135153982 16:20036536-20036558 CAAAGTCACGTCTTACATGGTGG + Intronic
1135209772 16:20514952-20514974 CAAAGGCACATCTTACATGGTGG - Intergenic
1135284125 16:21178857-21178879 CAGAGGCACTTCTTACATGGCGG - Intronic
1135550863 16:23397252-23397274 CAGAGTCACAACTTACACATAGG + Intronic
1135617108 16:23920974-23920996 CAAAGTCACGTCTTACATGGTGG + Intronic
1135723386 16:24835733-24835755 CACAGAGACATCTTACATGGCGG + Intergenic
1135786081 16:25350492-25350514 CAAAGTCACATCTTACATGGTGG - Intergenic
1135806191 16:25545155-25545177 CAAAGTCACGTCTTACATGGTGG + Intergenic
1135987522 16:27194911-27194933 CAAAGGCACATCTTACATGGTGG + Intergenic
1136054106 16:27675210-27675232 CAAAGTCACAGCTTACATGGTGG + Intronic
1137843589 16:51664890-51664912 CAATGTCACATCTTACATGGTGG - Intergenic
1137931910 16:52596685-52596707 AAAAGTCACATCTTACATGGTGG + Intergenic
1137987732 16:53124376-53124398 CAAAGTCACATCTTACATGGTGG + Intronic
1138144771 16:54598634-54598656 CAAAGGCACATCTTACATGGTGG + Intergenic
1138292530 16:55860169-55860191 CAAAGGCACATCTTACATGGTGG - Intronic
1138297073 16:55896140-55896162 CAAAGTCACATCTTACATGGTGG + Intronic
1138548305 16:57732887-57732909 CAAAGGCACATCTTACATGGTGG + Intergenic
1138608774 16:58106424-58106446 CAAAGTCACATCTTGCATGGTGG + Intergenic
1138956111 16:61972185-61972207 CAAAGTCACATCTTACATGGTGG - Intronic
1139110209 16:63881326-63881348 CAAAGGCACATCTTACATGGTGG + Intergenic
1139164186 16:64546704-64546726 CAAAGTCACATCTTGCATGGTGG + Intergenic
1139240632 16:65388470-65388492 CCAAGTCACATCTTACATGGCGG + Intergenic
1139276835 16:65735738-65735760 CAAAGTCACATCTTGCATGGTGG + Intergenic
1139501437 16:67369701-67369723 CAAAGTCACGTCTTACATGGTGG + Intronic
1140574145 16:76145208-76145230 CAGGGTCACGTCTTACATGGTGG + Intergenic
1140602380 16:76492734-76492756 CAAAGCCACATCTTACATGGTGG - Intronic
1140628346 16:76821853-76821875 CAAAGTCACATCTTACGTGGTGG + Intergenic
1140736572 16:77903274-77903296 CAGAGGTAGAGCTTACATAGCGG - Intronic
1140848293 16:78910671-78910693 CAAAGTCACATCTTACATGGTGG + Intronic
1141045053 16:80708383-80708405 CAAAGTCACGTCTTACATGGGGG - Intronic
1141201625 16:81902843-81902865 CAAAGTCACATCTTACATGGTGG + Intronic
1141214079 16:82008127-82008149 CAAAGTCACGTCTTACATGGTGG - Intronic
1141339514 16:83189959-83189981 CAAAGTCACGTCTTACATGGGGG - Intronic
1141345173 16:83238302-83238324 CAAAGGCACATCTTACATGGCGG + Intronic
1141345691 16:83243328-83243350 GAGAGGCACATCTTACATGGCGG + Intronic
1141438785 16:84016076-84016098 CAAAGTCACGTCTTACATGGTGG + Intronic
1141529978 16:84639493-84639515 CAAAGGCACATCTTACATGGTGG - Intergenic
1141536949 16:84688426-84688448 CAAAGGCACATCTTACATGGTGG - Intergenic
1143912946 17:10267032-10267054 CAAAGTCACATCTTACATGGTGG + Intergenic
1144017304 17:11208326-11208348 CAAAGTCACATCTTACATGATGG + Intergenic
1144138832 17:12325854-12325876 CAAAGTCACGTCTTACATGGTGG + Intergenic
1144281906 17:13734695-13734717 CAAAGGTACATTTTACATGGTGG - Intergenic
1144373095 17:14611644-14611666 CAAAGGCACATCTTACATGGAGG + Intergenic
1146543973 17:33722246-33722268 CCAAGTCACATCTTACATGGTGG - Intronic
1146839213 17:36138225-36138247 CAAAGGCACATCTTACATGGTGG + Intergenic
1147338977 17:39742710-39742732 CTGAGGGACAACTCACATGGGGG - Exonic
1149189921 17:54049478-54049500 CAAAGTCACATCTTACATGGTGG + Intergenic
1149236641 17:54598755-54598777 GAAAGGTACATCTTACATGGTGG - Intergenic
1150593389 17:66582533-66582555 CAAAGTCACATCTTACATGGCGG - Intronic
1150638751 17:66934925-66934947 CAAAGGCACATCTTACATGGTGG + Intergenic
1150874845 17:68959341-68959363 CAAAGTCACATCTTACATGGTGG - Intergenic
1150943199 17:69715966-69715988 AAGAGGCACATCTTACATGGTGG + Intergenic
1150960858 17:69910781-69910803 CAAAGTCACATCTTACATGGTGG + Intergenic
1150967500 17:69988119-69988141 TAAAGTCACATCTTACATGGTGG - Intergenic
1150971379 17:70032058-70032080 AAAAGTCACATCTTACATGGTGG + Intergenic
1151058366 17:71060513-71060535 CAAAGGCACATCTTACATGGAGG - Intergenic
1151059095 17:71070297-71070319 CGAAGTCACATCTTACATGGTGG - Intergenic
1151111998 17:71689453-71689475 CAAAGGCACATCTTACATGGGGG + Intergenic
1151119158 17:71772946-71772968 CAAAGTCACTTCTTACATGGTGG - Intergenic
1151121423 17:71797133-71797155 CAAAGTCACATCTTACATAGTGG - Intergenic
1151123760 17:71822506-71822528 CAAAGGCACATCTTACATGGTGG + Intergenic
1151137432 17:71960614-71960636 CAAAGGCACATCTTACATGGTGG + Intergenic
1151172782 17:72261639-72261661 CAAAGGCACATCTTACATGGAGG + Intergenic
1151339888 17:73464365-73464387 CAAAGCCACATCTTACATGGTGG - Intronic
1151828137 17:76535057-76535079 CAGAGTTACAACCAGCAGGGAGG + Intronic
1152026605 17:77813623-77813645 CAAAGTCACATCTTACTTGGCGG - Intergenic
1152993410 18:383885-383907 CAAAGTCACATCTTACATGGTGG + Intronic
1153182890 18:2455811-2455833 CAAAGTCACATCTTACATGGTGG - Intergenic
1153337243 18:3937349-3937371 CAAAGTTACGTCTTACAAGGTGG + Intronic
1153537996 18:6123515-6123537 CAAAGGCACATCTTACATGGTGG - Intronic
1154087531 18:11322100-11322122 CAAAGTCACCTCTTACATGGTGG + Intergenic
1154513904 18:15140193-15140215 CAAAGTCACATCTTACATGGAGG + Intergenic
1155798039 18:30064997-30065019 CAAAGGCACATCTTACATGGTGG + Intergenic
1156151456 18:34248993-34249015 CAAAGTCACATCTTACTTGGTGG + Intergenic
1156359436 18:36371398-36371420 CAAAGGCACATCTTACATGGTGG + Intronic
1156382663 18:36578275-36578297 CAAAGGCACATCTTACATGGTGG + Intronic
1156704084 18:39858952-39858974 CAAAGTCTCATCTTACATGGTGG - Intergenic
1156884223 18:42115556-42115578 CAAAGACACATCTTACATGGTGG + Intergenic
1156917984 18:42484247-42484269 CAAAGTCACATCTTACATGGTGG + Intergenic
1156976707 18:43230618-43230640 AAAAGTCACATCTTACATGGTGG - Intergenic
1157549109 18:48568740-48568762 CAAAGGCACATCTTACATGGCGG + Intronic
1157719466 18:49912656-49912678 CAAAGGAACATCTTACATGGCGG - Intronic
1157940986 18:51929043-51929065 CAAAGTTACATCTTACATGGTGG - Intergenic
1157941256 18:51930985-51931007 CAAAGTCACATCTTACATGGGGG - Intergenic
1157950850 18:52035273-52035295 CAAAGGCACATCTTACATGGCGG - Intergenic
1158081264 18:53593576-53593598 CAAAGTCACATCTTACATGGTGG - Intergenic
1158106467 18:53890366-53890388 CAAAGTCACATCTTACATGATGG + Intergenic
1158406692 18:57166111-57166133 CAAAGTCACATCTTACATGGTGG + Intergenic
1158487445 18:57880116-57880138 CAAAGTCACATCTTACATGGTGG - Intergenic
1158488711 18:57891141-57891163 CAGAGTCATGTCTTACATGGTGG - Intergenic
1158525796 18:58212405-58212427 CAAAGTCCCATCTTACATGGTGG + Intronic
1158554889 18:58466825-58466847 CAAAGGCACATCTTACATGGTGG - Intergenic
1159260045 18:66002521-66002543 AAAAGGTACATCTTACATGGTGG - Intergenic
1159312803 18:66732608-66732630 CAAAGTCACATCTTACATGGTGG + Intergenic
1159588298 18:70303229-70303251 CAGAGTTATAAATAACATGAGGG - Intronic
1159606555 18:70480259-70480281 CAAAGGTACATCTTACACGGTGG - Intergenic
1159721472 18:71897440-71897462 CAAAGTCACGTCTTACATGGTGG + Intergenic
1159744943 18:72221413-72221435 CAAAGGCACATCTTACATGGTGG - Intergenic
1159750281 18:72292643-72292665 CAAAGTCACATCTTACATGGCGG - Intergenic
1159776507 18:72608870-72608892 CAAAGTCACATCTTACATGATGG + Intronic
1159805966 18:72958566-72958588 CAAAGGTACAACTTACATCATGG + Intergenic
1159896133 18:73997480-73997502 CAAAGGCACATCTTACATGGTGG - Intergenic
1160153080 18:76410019-76410041 CAAAGGCACATCTTACATGGCGG - Intronic
1160248017 18:77175883-77175905 CAGAGTCACGTTTTACATGGTGG + Intergenic
1160303671 18:77710125-77710147 CAAAGTCACATCTTACATGGTGG + Intergenic
1160547619 18:79670855-79670877 CAAAGTCACGACTTACATGGCGG - Intergenic
1160806277 19:993574-993596 CAGAGGAACCAGTTACATGGAGG - Intronic
1161173831 19:2827929-2827951 CAAAGTCACATCTTACGTGGCGG + Intronic
1163096829 19:15064754-15064776 CAAAGGCACATCTTACATGGTGG + Intergenic
1163346378 19:16745122-16745144 AAGAGGCACATCTTACATGGTGG + Intronic
1163354765 19:16803071-16803093 CAAAGTCACGTCTTACATGGTGG + Intronic
1163383318 19:16983030-16983052 GAAAGGTACATCTTACATGGTGG - Intronic
1164566268 19:29328198-29328220 CAAAGGCACATCTTACATGGTGG + Intergenic
1164799057 19:31060874-31060896 CAAAGGCACATCTTACATGGTGG - Intergenic
1164857744 19:31538248-31538270 CAAAGGCACATCTTACATGGTGG - Intergenic
1164959760 19:32417670-32417692 CAAAGTTAAGTCTTACATGGCGG - Intronic
1166164808 19:40979894-40979916 CAAAGACACATCTTACATGGAGG + Intergenic
1166226968 19:41402053-41402075 CAAAGTCACATCTTACATGGTGG + Intronic
1168457089 19:56520999-56521021 CAAAGTCACTTCTTACATGGTGG + Intronic
924963535 2:56563-56585 CAAAGTCACGTCTTACATGGTGG + Intergenic
924966180 2:78378-78400 CAAAGTCACGTCTTACATGGTGG + Intergenic
925208797 2:2029389-2029411 CAAAGTCACGTCTTACATGGCGG + Intronic
925256216 2:2490866-2490888 CAAAGTCACGTCTTACATGGTGG + Intergenic
925590204 2:5501782-5501804 CAAAGTCACGTCTTACATGGTGG - Intergenic
925678943 2:6396518-6396540 CAAAGTCACGTCTTACATGGAGG + Intergenic
925871566 2:8276268-8276290 CAAAGTCACGTCTTACATGGTGG - Intergenic
925916532 2:8610942-8610964 CAAAGGCACATCTTACATGGTGG + Intergenic
925931691 2:8713367-8713389 CAAAGTTACGTCTTACATGGTGG - Intergenic
926710017 2:15871868-15871890 CAAAGTCACATCTTACACGGTGG - Intergenic
926804741 2:16696930-16696952 CAAAGTCACATCTTACATGGTGG - Intergenic
926929743 2:18024804-18024826 CAAAGGCACATCTTACATGGCGG + Intronic
926984262 2:18604538-18604560 CAGAGTTATAACTTTTTTGGGGG + Intergenic
927126900 2:20020472-20020494 CACAGGCACATCTTACATGGTGG + Intergenic
927175604 2:20404730-20404752 CAAAGGGACATCTTACATGGTGG + Intergenic
927267073 2:21162940-21162962 CAAAGTCACATCTTACATGGTGG + Intergenic
927358511 2:22204215-22204237 AAGAGGCACATCTTACATGGTGG + Intergenic
928133770 2:28672710-28672732 CAAAGGAACATCTTACATGGCGG - Intergenic
928280907 2:29945499-29945521 CAAAGTCACATCTTACATGGTGG + Intergenic
928749237 2:34452862-34452884 CAAAGTCACATCTTACATGGTGG + Intergenic
928860795 2:35855194-35855216 CAAAGTCACATCTTACATGGTGG + Intergenic
930324534 2:49898964-49898986 CCAAGGTACATCTTACATGGTGG + Intergenic
930937415 2:56970538-56970560 CTTAATTACAACTTCCATGGTGG + Intergenic
931803454 2:65780841-65780863 GAAAGTCACATCTTACATGGTGG + Intergenic
931824769 2:65989040-65989062 CAAAGGCACATCTTACATGGTGG + Intergenic
932588512 2:73047646-73047668 CAAAGTCACATCTTACATGGCGG - Intronic
932779605 2:74551871-74551893 CAGAGCTAAAACTAACAAGGTGG - Intronic
932839578 2:75069133-75069155 CAAAGTCACATCTTACATGGTGG - Intronic
933006599 2:77003542-77003564 CAAAGTCACATCTTACATGGCGG - Intronic
933125319 2:78597386-78597408 CAAAGCCACATCTTACATGGTGG - Intergenic
933361626 2:81293750-81293772 TAAAGTCACATCTTACATGGTGG - Intergenic
933468505 2:82688471-82688493 CAAAGTCACATCTTGCATGGCGG + Intergenic
933689790 2:85171108-85171130 CAGAGGCACGTCTTACATGGTGG + Intronic
933798557 2:85941631-85941653 CAAAGTCACGTCTTACATGGTGG + Intergenic
934926631 2:98386479-98386501 CAAAGTCACATCTTACGTGGCGG - Intronic
935140774 2:100350990-100351012 CACAGTTACCACCTACATGGAGG + Intergenic
935385350 2:102493438-102493460 CAAAGTCACGTCTTACATGGTGG + Intronic
936261308 2:110961791-110961813 CAAAGTCACGTCTTACATGGTGG + Intronic
936633149 2:114226318-114226340 CAAAGGTGCATCTTACATGGTGG - Intergenic
936794877 2:116193400-116193422 CAAAGGCACATCTTACATGGTGG + Intergenic
936872288 2:117147229-117147251 CAAAGTCACATCTTACATGGTGG + Intergenic
936897721 2:117446779-117446801 GAAAGTCACATCTTACATGGTGG - Intergenic
937138368 2:119575388-119575410 CAGAGTTGCAGATAACATGGAGG - Intronic
937433577 2:121861620-121861642 CAAAGGGACATCTTACATGGTGG + Intergenic
937498686 2:122453537-122453559 CAAAGTCACATTTTACATGGTGG + Intergenic
937612161 2:123875362-123875384 CAAAGTCACATCTTACATGGTGG - Intergenic
937640365 2:124204653-124204675 CAAAGGTACATCTTACATGGTGG + Intronic
937702801 2:124882835-124882857 CAAAGGCACATCTTACATGGAGG + Intronic
937836826 2:126479553-126479575 CAAAGTCACACTTTACATGGCGG - Intergenic
938099676 2:128490238-128490260 GGGGGTTACAACGTACATGGTGG - Intergenic
938514144 2:131984804-131984826 CAAAGTCACATCTTACATGGAGG + Intergenic
939099051 2:137873281-137873303 CAAAGTCGCATCTTACATGGTGG - Intergenic
939436412 2:142183087-142183109 CAAAGTCACATCTTAAATGGTGG - Intergenic
939468190 2:142585137-142585159 CATAGTCACATCTTACATGGTGG - Intergenic
940102260 2:150054878-150054900 CAAAGTCATATCTTACATGGTGG + Intergenic
940485110 2:154288134-154288156 GAAAGTGACATCTTACATGGAGG + Intronic
940505232 2:154545782-154545804 CAAAGGTATATCTTACATGGTGG - Intergenic
940631930 2:156251011-156251033 CAAAGGCACATCTTACATGGTGG - Intergenic
940819410 2:158335549-158335571 CAAAGTCACATCTTACATGGTGG + Intronic
941414837 2:165206898-165206920 CAAAGGCACATCTTACATGGTGG - Intergenic
941463630 2:165799984-165800006 CAAAGTCACGTCTTACATGGTGG - Intergenic
941682492 2:168414201-168414223 CAAAGGCACATCTTACATGGTGG + Intergenic
941967129 2:171311613-171311635 CAAAGTCACATCTTACATGGAGG - Intergenic
942234469 2:173890526-173890548 CAAAGGCACATCTTACATGGTGG - Intergenic
942839944 2:180348414-180348436 CAAAGTCACATCTTACATGGTGG + Intergenic
942904870 2:181168023-181168045 CAAAGTCACATCTTACATGGAGG + Intergenic
943000516 2:182322483-182322505 CAAAGGCACATCTTACATGGCGG - Intronic
943017162 2:182527887-182527909 GAAAGTCACATCTTACATGGTGG - Intergenic
943208621 2:184932399-184932421 CAAAGTCACGTCTTACATGGAGG + Intronic
943279274 2:185910461-185910483 CAAAGACACATCTTACATGGTGG - Intergenic
943393883 2:187307278-187307300 CAAAGTCACATCTTACATGGTGG - Intergenic
943701805 2:190995429-190995451 CAAAGTCACATCTTACATGGTGG + Intronic
943811136 2:192191094-192191116 AAGTTTTATAACTTACATGGTGG + Intronic
944093716 2:195943089-195943111 CAAAGTCACATCTTACATGGTGG - Intronic
944289598 2:197990533-197990555 CAAAGGCACATCTTACATGGCGG + Intronic
945051179 2:205825665-205825687 TAAAGTCACATCTTACATGGTGG - Intergenic
945170062 2:206986465-206986487 CAAAGTCACGTCTTACATGGTGG - Intergenic
945293925 2:208151842-208151864 CAAAGTCACATCTTACAGGGCGG + Intergenic
945330591 2:208535741-208535763 CAAAGGCACATCTTACATGGTGG + Intronic
945356043 2:208841066-208841088 CAAAGTCACATCTTACATGGTGG + Intronic
945475639 2:210279035-210279057 CAAAGTAACATCTTACATGGTGG + Intergenic
945760968 2:213915068-213915090 CAAAGTCACGTCTTACATGGTGG + Intronic
945828516 2:214754648-214754670 CAGAGTTCCAATTTACATTTAGG + Intronic
946440783 2:219693399-219693421 CAAAGTCACATCTTACATGGTGG + Intergenic
946521577 2:220470264-220470286 CAAAGGCACAACTCACATGGTGG - Intergenic
946635706 2:221723509-221723531 CAAAGGAACATCTTACATGGAGG - Intergenic
946732369 2:222721768-222721790 CAAAGTCACAGCTTACATGGCGG + Intergenic
946755125 2:222936818-222936840 CAAAGGGACATCTTACATGGCGG + Intronic
946803528 2:223446751-223446773 CAAAGGCACATCTTACATGGTGG - Intergenic
946977781 2:225172915-225172937 AAGAGTGACAACTCACATGGTGG + Intergenic
946999981 2:225442955-225442977 CAAAGGCACATCTTACATGGTGG + Intronic
947036260 2:225860612-225860634 CAAAGTCACATATTACATGGTGG + Intergenic
947093589 2:226541493-226541515 CAAAGTCACATCTTACATGGTGG + Intergenic
947154934 2:227153036-227153058 CAAAGTTATATCTTACATGGTGG + Intronic
947832331 2:233150339-233150361 CAAAGTCACGTCTTACATGGTGG - Intronic
948009274 2:234637622-234637644 CAAAGTCACATCTTACATGATGG - Intergenic
948131148 2:235601494-235601516 CAAAGTTACATCTAACATGGGGG + Intronic
948252530 2:236541859-236541881 CAAAGTCACATCTTACGTGGTGG - Intergenic
948672877 2:239579711-239579733 CAGAGTCACGTCTTACATGGTGG + Intronic
1169468965 20:5866882-5866904 CAAAGTCACGTCTTACATGGCGG + Intergenic
1169594389 20:7181547-7181569 CAAAGTCACATCTTACATGGTGG - Intergenic
1169826796 20:9777452-9777474 CAAAGTCACATCTTACATGCTGG - Intronic
1169884522 20:10383664-10383686 CAAAGTGACATCTTACATGGTGG + Intergenic
1170342842 20:15348649-15348671 CAAAATCACATCTTACATGGTGG + Intronic
1170648470 20:18217434-18217456 CAAAGTCACGTCTTACATGGAGG - Intergenic
1170952481 20:20949549-20949571 CAAAGTCACATCTTACATGGTGG + Intergenic
1171399729 20:24865066-24865088 CAAAGGCACATCTTACATGGTGG - Intergenic
1171468484 20:25350506-25350528 CAAAGTCACATCTTACATGGCGG - Intronic
1171480157 20:25448964-25448986 CAAAGTCACGTCTTACATGGTGG - Intronic
1171873141 20:30546537-30546559 CAAAGGTACATCCTACATGGTGG - Intergenic
1173182979 20:40818565-40818587 CAAAGGCACATCTTACATGGTGG + Intergenic
1173960180 20:47065011-47065033 CAAAGTCACGTCTTACATGGTGG + Intronic
1174092842 20:48063080-48063102 CAAAGTCACATCTTACATGGCGG - Intergenic
1174537573 20:51263959-51263981 CAAAGGCACATCTTACATGGGGG + Intergenic
1174703158 20:52629708-52629730 CAAAGTCACATCTTACATGGTGG - Intergenic
1174960734 20:55154287-55154309 CAAAGGCACATCTTACATGGTGG - Intergenic
1175337227 20:58204586-58204608 CAAAGTCACATTTTACATGGTGG - Intergenic
1175693904 20:61086832-61086854 CAAAGTCACATCATACATGGTGG + Intergenic
1175830684 20:61963977-61963999 CAAAGTCACGTCTTACATGGCGG + Intronic
1176779636 21:13178091-13178113 CAAAGTCACATCTTACATGGAGG - Intergenic
1177013719 21:15758489-15758511 CAAAGGCACATCTTACATGGTGG - Intronic
1177162219 21:17560001-17560023 CATGATTACAACTTAGATGGTGG + Intronic
1177201654 21:17963471-17963493 CAAAGGCACATCTTACATGGTGG + Intronic
1177525056 21:22279819-22279841 CAAAGGCACATCTTACATGGTGG + Intergenic
1177601825 21:23325369-23325391 CAAAGGCACATCTTACATGGTGG - Intergenic
1177607468 21:23400229-23400251 CAAAGTCACGTCTTACATGGTGG + Intergenic
1177636497 21:23793889-23793911 CAAAGTCACATCTTACATGGCGG - Intergenic
1177654994 21:24005136-24005158 CAAAGACACATCTTACATGGTGG + Intergenic
1177685780 21:24435448-24435470 CAAAGGCACATCTTACATGGTGG - Intergenic
1177759747 21:25389887-25389909 CAAAGGCACATCTTACATGGTGG - Intergenic
1177768206 21:25483143-25483165 CAAAGTCACATCTTACATGGTGG + Intergenic
1177918580 21:27123166-27123188 CAAAGTCACGTCTTACATGGTGG + Intergenic
1177931373 21:27288329-27288351 CAAAGGCACATCTTACATGGCGG + Intergenic
1177935019 21:27334496-27334518 CAAAGGCACATCTTACATGGTGG + Intergenic
1177977267 21:27867131-27867153 CAAAGTCACATCTTACATGGAGG - Intergenic
1178003643 21:28192557-28192579 CAAAGTCACGTCTTACATGGAGG + Intergenic
1178025389 21:28460499-28460521 CAAAGGGACATCTTACATGGTGG - Intergenic
1178251443 21:31007286-31007308 CAAAGTCACATCTTACATGGCGG + Intergenic
1178261525 21:31104496-31104518 CAAAGTCACATCTTACTTGGCGG + Intergenic
1178261638 21:31105506-31105528 CAGAGTCACGTCTAACATGGTGG + Intergenic
1178266617 21:31148400-31148422 CAAAGTCACATCTTACATGGCGG - Intronic
1178365266 21:31984970-31984992 CAAAGTCACGTCTTACATGGTGG + Intronic
1178634349 21:34289256-34289278 CAAAGTCACATCTTACATGGTGG + Intergenic
1178675589 21:34628844-34628866 CAAAGTCACATCTTACATGGTGG + Intergenic
1178675610 21:34629157-34629179 CAAAGTCACATCTTACATGGTGG + Intergenic
1179176784 21:39013690-39013712 AAAAGTCACATCTTACATGGCGG + Intergenic
1179265859 21:39802835-39802857 CAAAGGTACATCTTACATGGAGG + Intergenic
1179384592 21:40930154-40930176 CAAAGTCACATCTTACATGGTGG + Intergenic
1179398226 21:41060528-41060550 CAAAGGCACATCTTACATGGTGG + Intergenic
1180120837 21:45747148-45747170 CAAAGGTGCATCTTACATGGTGG + Intronic
1180152834 21:45960617-45960639 CAAAGGCACATCTTACATGGTGG + Intergenic
1180153095 21:45962378-45962400 CAAAGGCACATCTTACATGGTGG + Intergenic
1181183549 22:21084774-21084796 AAGAGGCACATCTTACATGGTGG + Intergenic
1182872027 22:33656269-33656291 CAAAGGCACATCTTACATGGTGG + Intronic
1184483454 22:44761842-44761864 CAAAGGAACATCTTACATGGTGG + Intronic
1184752278 22:46493786-46493808 CAAAGTCACATCTTACATGGTGG - Intronic
1184819819 22:46901691-46901713 AAGTGTTATAACTCACATGGGGG + Intronic
949094122 3:65586-65608 CAGAGGTACATCTTACGTGGTGG - Intergenic
949264426 3:2140085-2140107 CAAAGGCACATCTTACATGGCGG - Intronic
949854611 3:8450010-8450032 CAAAGTCACATCTTACATGGTGG + Intergenic
950412357 3:12847350-12847372 TAAAGTCACATCTTACATGGTGG - Intronic
950525732 3:13521961-13521983 CAAAGTCACATCTTACATGGCGG + Intergenic
950806033 3:15603796-15603818 CAGATTTTGAACTTGCATGGGGG - Intronic
950856715 3:16112572-16112594 CAAAGTCACATCTTACATGGTGG + Intergenic
951019805 3:17770237-17770259 CAGAGTTACATGTTTTATGGAGG + Intronic
951183282 3:19683305-19683327 CAATGTCACATCTTACATGGTGG + Intergenic
951659617 3:25048028-25048050 CAAAGGCACATCTTACATGGCGG - Intergenic
952022614 3:29041226-29041248 CAAAGTCACATCTTACATGGCGG - Intergenic
952029246 3:29120831-29120853 CAGAGGCACGTCTTACATGGTGG - Intergenic
952410165 3:33041959-33041981 CAGAGTTACCATTTATGTGGGGG - Intronic
952620189 3:35328886-35328908 CAAAGTCACGTCTTACATGGTGG + Intergenic
952844108 3:37672402-37672424 CAAAGTCACGTCTTACATGGTGG - Intronic
954895527 3:53971918-53971940 CAAAGTCACGTCTTACATGGTGG - Intergenic
954948971 3:54452222-54452244 CAAAGGAACATCTTACATGGTGG + Intronic
955163948 3:56492156-56492178 AAAAGTCACATCTTACATGGTGG - Intergenic
955465387 3:59231353-59231375 CAAAGGCACATCTTACATGGTGG + Intergenic
955468802 3:59264547-59264569 CAAAGGCACATCTTACATGGTGG - Intergenic
955529885 3:59862212-59862234 CAAAGGCACATCTTACATGGTGG + Intronic
955564966 3:60233863-60233885 CAAAGGCACATCTTACATGGCGG - Intronic
955644851 3:61126449-61126471 AAGAGGCACATCTTACATGGTGG + Intronic
955848376 3:63192952-63192974 CAAAGGGACATCTTACATGGAGG + Intergenic
956237982 3:67096298-67096320 CAGGGTTACAACTTTCATGGTGG + Intergenic
956363370 3:68472293-68472315 CAAAGTGACTTCTTACATGGTGG - Intronic
956534864 3:70264965-70264987 CAAAGTCACATCTTACATGGTGG + Intergenic
956765989 3:72485017-72485039 CAAAGTCACGCCTTACATGGTGG + Intergenic
956994469 3:74808427-74808449 CAAAGGCACATCTTACATGGTGG + Intergenic
957118215 3:76055092-76055114 CAAAGTCACATCTTACATGGCGG + Intronic
957212426 3:77276836-77276858 CAAAGTCACATATTACATGGTGG + Intronic
957219404 3:77362808-77362830 CAAAGTCACATCTTACATGGTGG + Intronic
957294270 3:78316540-78316562 CAAAGGCACATCTTACATGGTGG + Intergenic
957377434 3:79376619-79376641 CAAAGGCACAACTTACATGGTGG - Intronic
957383921 3:79470750-79470772 CAAAGTCACATCTTTCATGGTGG - Intronic
957454743 3:80426945-80426967 CAAAGTCACATCTTACATGGAGG - Intergenic
957457776 3:80473683-80473705 CAAAATTGCATCTTACATGGTGG - Intergenic
957474543 3:80706305-80706327 CAAAGTCACATCTTACATGATGG + Intergenic
957779310 3:84797972-84797994 CAAAGGGACATCTTACATGGTGG - Intergenic
957857028 3:85892583-85892605 CAAAGGCACATCTTACATGGTGG - Intronic
957958729 3:87223027-87223049 CAAAGTCACATCTTACATGGTGG - Intergenic
958090095 3:88866364-88866386 AAGAGGCACATCTTACATGGTGG - Intergenic
958196160 3:90244786-90244808 CAAAGTTACTTCTTACCTGGTGG - Intergenic
958419349 3:93913430-93913452 CAAAGTTACTTCTTACCTGGTGG - Intronic
958672873 3:97227537-97227559 AAGAGTTACAGCTTGCAAGGTGG + Intronic
959177923 3:102940325-102940347 CAAAGGCACATCTTACATGGTGG - Intergenic
959732910 3:109624531-109624553 CAAAGTTACATCTTACATGGTGG - Intergenic
959804857 3:110539300-110539322 AAGAGGCACATCTTACATGGTGG - Intergenic
959818659 3:110705247-110705269 CAAAGGTACATCTTACATGGTGG + Intergenic
960428350 3:117536895-117536917 CAAAGGCACATCTTACATGGTGG - Intergenic
962206595 3:133440099-133440121 CAAAGGCACATCTTACATGGTGG + Intronic
962547159 3:136448411-136448433 CAAAGGGACATCTTACATGGTGG + Intronic
962674048 3:137739716-137739738 GAGAGATACAAATTACTTGGAGG - Intergenic
962684888 3:137837863-137837885 CAAAGGGACATCTTACATGGCGG - Intergenic
963134483 3:141888816-141888838 CAAAGTCACATCTTACATGGCGG - Intronic
963306560 3:143659986-143660008 CAAAGTTACGTCTTACACGGTGG - Intronic
963333757 3:143947668-143947690 CAAAGTCACATCTTACATGGTGG + Intergenic
963400933 3:144798149-144798171 CAAAGGTACATCTTACATGGTGG + Intergenic
963539342 3:146566161-146566183 CAAAGACACATCTTACATGGTGG + Intergenic
963975066 3:151471184-151471206 CAAAGTAACGTCTTACATGGTGG - Intergenic
964268139 3:154923324-154923346 CAGAGTTTCAAATTACATGAAGG + Intergenic
964855798 3:161144068-161144090 CAGAGGTAAAACTCCCATGGAGG + Intronic
965037030 3:163452207-163452229 CAGAGTCACATCTCACATGATGG - Intergenic
965102054 3:164310581-164310603 CAAAGGCACATCTTACATGGTGG + Intergenic
965275640 3:166678421-166678443 CAAAGGCACATCTTACATGGTGG + Intergenic
965277850 3:166710056-166710078 CAAAGTCACATCTTACATGGTGG + Intergenic
965304099 3:167042571-167042593 CAAAGTCACATCTTACATGGTGG - Intergenic
965307385 3:167083358-167083380 CAAAGTTACATCTTACACAGCGG + Intergenic
965649357 3:170918126-170918148 CAAAGGCACATCTTACATGGTGG - Intergenic
965929677 3:174028034-174028056 CAAAGTCACATCTTACATGGTGG - Intronic
965929921 3:174029847-174029869 CAAAGTCACATCTTACATGCTGG - Intronic
966051791 3:175626110-175626132 CAGTGTTAGCACATACATGGAGG - Intronic
966138818 3:176731660-176731682 CAAAGGCACATCTTACATGGTGG - Intergenic
966453191 3:180085663-180085685 CAAAGTCACAACTTACATGGTGG - Intergenic
967055877 3:185827779-185827801 CAAAGGCACATCTTACATGGGGG + Intergenic
967595654 3:191324581-191324603 CAAAGTGACATCTTATATGGTGG - Intronic
967963843 3:194945384-194945406 CAGAGGTAAAAATTAAATGGTGG - Intergenic
968524949 4:1051923-1051945 CAAAGGCACATCTTACATGGTGG - Intergenic
969108342 4:4825328-4825350 CAAAGTCACATCTTACATGGTGG + Intergenic
969155656 4:5207433-5207455 CAAAGTCACGTCTTACATGGTGG - Intronic
969190169 4:5512145-5512167 CAAAGGCACATCTTACATGGTGG + Intergenic
969354422 4:6617039-6617061 CAAAGTCACGTCTTACATGGTGG + Intronic
970059482 4:12015550-12015572 CAAAGTTACAAATTATTTGGAGG + Intergenic
970146791 4:13044340-13044362 CAAAGGCACATCTTACATGGTGG + Intergenic
970266028 4:14287280-14287302 CAAAGTCACATCTTATATGGCGG + Intergenic
970303232 4:14703368-14703390 CAGAGTCATATCTTACATGGTGG - Intergenic
970340286 4:15099257-15099279 CAAAGTCACATCTTACATGGTGG - Intergenic
970465819 4:16321872-16321894 CAAAGTCACATCTTACATGGTGG + Intergenic
970569723 4:17367943-17367965 CAAAGTCACATCTAACATGGTGG - Intergenic
970766173 4:19551472-19551494 GAAAGGTACATCTTACATGGTGG + Intergenic
970789092 4:19835348-19835370 CAAAGTCACATCTTCCATGGTGG - Intergenic
970800291 4:19965576-19965598 CAAAGTCACATCTTACATGGTGG + Intergenic
970932256 4:21526322-21526344 CAAAGGGACATCTTACATGGCGG - Intronic
970970302 4:21975552-21975574 CAAAGGCACATCTTACATGGTGG + Intergenic
971021861 4:22545347-22545369 AAGAGGCACATCTTACATGGTGG + Intergenic
971077915 4:23171619-23171641 CAAAGTCACATTTTACATGGAGG - Intergenic
971208374 4:24592072-24592094 CAAAGGCACATCTTACATGGTGG - Intergenic
971248133 4:24948920-24948942 CAGAGGTACATCTTACATAGTGG - Intronic
971423554 4:26494920-26494942 CAAAGTCACATCTTACATGGCGG - Intergenic
971498476 4:27293113-27293135 CAAAGTCACCTCTTACATGGAGG - Intergenic
971499608 4:27304364-27304386 CAAAGTCACACCTTTCATGGTGG + Intergenic
971848833 4:31957610-31957632 CAAAGGGACATCTTACATGGTGG + Intergenic
971918291 4:32904221-32904243 CAAAGGCACATCTTACATGGTGG + Intergenic
971933563 4:33117791-33117813 CAAAGTCACGTCTTACATGGTGG - Intergenic
972023244 4:34341839-34341861 CAAAGTCACATCTTACCTGGTGG + Intergenic
972363211 4:38348067-38348089 CAAAGTCACATCTTACATGGTGG + Intergenic
972428652 4:38959463-38959485 CAAAGTCACGTCTTACATGGCGG - Intergenic
972574984 4:40343374-40343396 CAAAGTCACATCTTACATGGTGG + Intronic
972832836 4:42833822-42833844 CAAAGTCACATTTTACATGGCGG - Intergenic
972880819 4:43419410-43419432 CAAAGGCACATCTTACATGGTGG + Intergenic
972896759 4:43631276-43631298 CAAAGTTTCATCTTACATGAAGG - Intergenic
973124104 4:46562334-46562356 CAGAATTACAACTTAAATAATGG + Intergenic
973262362 4:48177891-48177913 AAGAGGCACATCTTACATGGCGG - Intronic
973598185 4:52513770-52513792 CAAAGTCACATCTTACGTGGAGG - Intergenic
974045274 4:56893130-56893152 CAAAGGTACATCTTACATGGTGG + Intergenic
974083448 4:57235562-57235584 CAAAATTACGTCTTACATGGTGG - Intergenic
974178551 4:58357241-58357263 CAAAGTCACATCTTACAAGGTGG - Intergenic
974511313 4:62845500-62845522 CAAAGGCACATCTTACATGGTGG + Intergenic
975213492 4:71728165-71728187 CAAAGTCACATCTTACATGGTGG - Intergenic
975273452 4:72465901-72465923 CAAAGTCACATCTTACATGGTGG - Intronic
975300214 4:72781588-72781610 TACAGTTAAAACTTACAAGGTGG - Intergenic
975735027 4:77372685-77372707 CAGAGCTACAACTCACAAGTGGG - Intronic
975874839 4:78824405-78824427 CAGAGTTACAACTTACATGGTGG + Intronic
976277311 4:83290581-83290603 CAAAGGCACATCTTACATGGTGG - Intergenic
976286571 4:83376490-83376512 GAAAGTTACTTCTTACATGGCGG + Intergenic
976377023 4:84357293-84357315 CAAAGTCACATCTTACATGGGGG - Intergenic
976973870 4:91142269-91142291 CAAAGGCACATCTTACATGGTGG - Intronic
976987178 4:91316087-91316109 CAAAGTTACGTCCTACATGGCGG - Intronic
976988259 4:91328964-91328986 CAAAGTCACATCTTACATGGCGG - Intronic
977013970 4:91669592-91669614 CAAAGGCACATCTTACATGGTGG + Intergenic
977030352 4:91875379-91875401 CAAAGGCACATCTTACATGGAGG - Intergenic
977053540 4:92161387-92161409 CAAAGTCACATCTTACATGGTGG + Intergenic
977073103 4:92417920-92417942 CAAAGTCACATCTTACATAGTGG - Intronic
977139545 4:93350961-93350983 CAAAGGCACATCTTACATGGAGG + Intronic
977197632 4:94082339-94082361 CAAAGTCACGCCTTACATGGTGG + Intergenic
977276088 4:94978900-94978922 CAAAGGCACACCTTACATGGTGG + Intronic
977827297 4:101548780-101548802 CAGAGATACAAATTACATGAAGG + Intronic
978045105 4:104115603-104115625 CAAAGGCACAACTTACATGATGG + Intergenic
978136608 4:105269912-105269934 CAAAGTCACATCTTACATGGCGG + Intronic
978183364 4:105829519-105829541 CAAAGTCACATCTTACATGGTGG + Intronic
978210557 4:106131173-106131195 CAAAGTCATATCTTACATGGCGG - Intronic
978323610 4:107525604-107525626 CAAAGTCATATCTTACATGGTGG + Intergenic
978892615 4:113848172-113848194 CAAAGTCACATCTTATATGGTGG + Intergenic
978982133 4:114959470-114959492 CAAAGGCACATCTTACATGGTGG + Intronic
979139086 4:117150308-117150330 CAAAGGCACATCTTACATGGTGG + Intergenic
979183297 4:117756967-117756989 GAAAGTCACATCTTACATGGAGG - Intergenic
979315621 4:119258640-119258662 CAAAGTCACATCTTACATGGTGG + Intronic
979405053 4:120299447-120299469 CAAAGGGACATCTTACATGGTGG - Intergenic
979442493 4:120767921-120767943 CAAAGTCACATTTTACATGGCGG - Intronic
979743709 4:124182219-124182241 CAAAGCCACGACTTACATGGTGG - Intergenic
979821071 4:125172605-125172627 CAAAGTCACATCTTACATGGTGG + Intergenic
979867778 4:125777449-125777471 CAAAGTCACATCTTACATGGTGG - Intergenic
979901523 4:126225230-126225252 CAAAGTCACGTCTTACATGGTGG - Intergenic
979948991 4:126867907-126867929 CAAAGTCACATCTTACTTGGTGG - Intergenic
980242063 4:130190349-130190371 CAAAGTTACATCTTACCTGGTGG - Intergenic
980274065 4:130625327-130625349 CAAAGGAACATCTTACATGGTGG + Intergenic
980480991 4:133386753-133386775 CAAAGTCACATCTTACATGGCGG - Intergenic
981422548 4:144567683-144567705 CAAAGTCACGTCTTACATGGTGG - Intergenic
981477859 4:145206580-145206602 CAGAGGTACATCTTACATGGTGG + Intergenic
981531593 4:145759480-145759502 CAGAATTACTAATAACATGGAGG + Intronic
981657436 4:147127804-147127826 CAAAGTCACATCTTACATGGCGG + Intergenic
981695107 4:147551886-147551908 CAAAGGCACATCTTACATGGTGG - Intergenic
981822194 4:148899170-148899192 CAAAGGCACATCTTACATGGAGG + Intergenic
982098110 4:151941885-151941907 CAAAGTCACATCTTACATGGTGG - Intergenic
982320643 4:154073356-154073378 CAAAGTCACATCTTACATGGTGG + Intergenic
982477093 4:155867368-155867390 CAAAGTTACATCTAACATGGAGG + Intronic
982495941 4:156092181-156092203 CAAAGTCATGACTTACATGGCGG + Intergenic
982587535 4:157261167-157261189 CAAAGGCACATCTTACATGGCGG + Intronic
982622240 4:157723088-157723110 CAAAGTCACATCTTACATGATGG - Intergenic
982788342 4:159561429-159561451 CAAAGGCACATCTTACATGGTGG - Intergenic
982802331 4:159720792-159720814 CAAAGTCACATCTTACATGGTGG - Intergenic
983017939 4:162638639-162638661 AAAAGTCACATCTTACATGGTGG - Intergenic
983348516 4:166558244-166558266 CAAAGTCACCTCTTACATGGTGG - Intergenic
983348779 4:166560212-166560234 CAAAGTCACCTCTTACATGGTGG - Intergenic
983394040 4:167169935-167169957 CAAAGTCACATCTTACATGGTGG - Intronic
983454942 4:167952160-167952182 CAAAGGCACATCTTACATGGTGG - Intergenic
983711531 4:170722776-170722798 CAAAGGCACATCTTACATGGTGG + Intergenic
983994130 4:174160320-174160342 CAAAGTCACACCTTACATGGTGG + Intergenic
984246262 4:177278548-177278570 CATAGGCACATCTTACATGGTGG - Intergenic
984279920 4:177658165-177658187 CAAAGGCACATCTTACATGGTGG - Intergenic
984346666 4:178537148-178537170 CAAAGTCACATCCTACATGGTGG + Intergenic
984399238 4:179240633-179240655 CAAAGGCACATCTTACATGGTGG - Intergenic
985982768 5:3486024-3486046 CAAAGTTACATCTTACGTGGTGG + Intergenic
986160756 5:5226307-5226329 CAAAGTCATACCTTACATGGTGG + Intronic
986220382 5:5763614-5763636 CAAAGACACATCTTACATGGTGG - Intergenic
986238531 5:5935396-5935418 CAGCGATACAGCTTGCATGGAGG + Intergenic
986250763 5:6056522-6056544 CAAAGGCACATCTTACATGGCGG - Intergenic
986316854 5:6595092-6595114 CAAAGTCACGTCTTACATGGTGG - Intergenic
986405775 5:7423542-7423564 CAAAGTCACGTCTTACATGGTGG - Intronic
986461744 5:7979596-7979618 CAAAGGCACATCTTACATGGTGG + Intergenic
986785132 5:11107134-11107156 CATAGTTACAACTTACATCTGGG - Intronic
986864888 5:11974625-11974647 CAAAGTTACCGCTTACATGATGG + Intergenic
987197624 5:15543250-15543272 CAAAGGTACGTCTTACATGGTGG + Intronic
987254833 5:16139323-16139345 CAAAGTCACATCTTACATGGTGG - Intronic
987457432 5:18164750-18164772 CAAAATCACATCTTACATGGTGG + Intergenic
987562515 5:19541610-19541632 CAAAGTCACATATTACATGGCGG + Intronic
987664101 5:20913964-20913986 AAGAGGCACATCTTACATGGTGG + Intergenic
987909140 5:24119235-24119257 CAAAGTCACATCTTACATGGTGG + Intronic
988136717 5:27181621-27181643 TTGAGTTACAACTTACAGGTGGG - Intergenic
988464266 5:31473369-31473391 CAGAGTAACATCTCAGATGGAGG - Intronic
988602827 5:32655480-32655502 CAAAGGCACATCTTACATGGTGG + Intergenic
988724929 5:33916925-33916947 CAAAGGCACATCTTACATGGAGG - Intergenic
988758590 5:34288232-34288254 AAGAGGCACATCTTACATGGTGG - Intergenic
988793472 5:34630799-34630821 CAAAGTCACGTCTTACATGGTGG - Intergenic
988804380 5:34726769-34726791 CAAAGGCACATCTTACATGGTGG - Intronic
988873116 5:35412777-35412799 CAAAGGCACATCTTACATGGTGG + Intergenic
989100486 5:37818416-37818438 CAAAGTCACATCTTACATGGCGG - Intronic
989407912 5:41082382-41082404 CAAAGTCACATCTTACATGGTGG - Intergenic
989656626 5:43752484-43752506 CAAAGCAACATCTTACATGGTGG + Intergenic
989656908 5:43754451-43754473 CAAAGGCACATCTTACATGGTGG + Intergenic
989707774 5:44358266-44358288 CAGAATTTCAACATACATTGTGG - Intronic
989747872 5:44852951-44852973 AAAAGTCACATCTTACATGGTGG + Intergenic
989846042 5:46142841-46142863 CAGAGTTAAAACTTTCTTTGTGG + Intergenic
990077710 5:51872161-51872183 AAAAGTCACATCTTACATGGTGG - Intergenic
990111524 5:52331418-52331440 AAGAGGCACATCTTACATGGAGG + Intergenic
990291397 5:54355247-54355269 CAAAGTCATGACTTACATGGTGG - Intergenic
990481297 5:56214016-56214038 CAGAGGCACATCTTACATGGTGG + Intronic
990607716 5:57427208-57427230 CAAAGTCACGTCTTACATGGAGG - Intergenic
991552117 5:67850022-67850044 CAAAGGGACATCTTACATGGCGG - Intergenic
993036748 5:82767542-82767564 CAGAGGGACATCTTACATGGTGG - Intergenic
993066926 5:83112702-83112724 CAAAGTCACATCTTACATGGTGG + Intronic
993067254 5:83114961-83114983 CAAAGTTACGTCTTACATGGTGG + Intronic
993117391 5:83734470-83734492 GAAAGTCACATCTTACATGGTGG - Intergenic
993117659 5:83736412-83736434 CAAAGTTACATCTTACATTGTGG - Intergenic
993238576 5:85348254-85348276 CAAAGTCACATATTACATGGTGG - Intergenic
993404504 5:87494641-87494663 CAAAGTCACATCTTACATGGTGG - Intergenic
993413332 5:87597619-87597641 CAAAGGTACATCTTACATGGAGG + Intergenic
993567026 5:89489035-89489057 CAAAGGCACAGCTTACATGGCGG + Intergenic
994000518 5:94773690-94773712 TAAAGTCACATCTTACATGGTGG + Intronic
994166132 5:96610172-96610194 CAAAGGCACATCTTACATGGTGG - Intronic
994179104 5:96744360-96744382 CAAAGTCACGTCTTACATGGAGG + Intronic
994338647 5:98599994-98600016 CAAAGTCACATCTTACATGGCGG - Intergenic
994732766 5:103513243-103513265 CTGAGTTTCAACTTTAATGGTGG - Intergenic
994762667 5:103876484-103876506 CAAAGGGACACCTTACATGGCGG + Intergenic
994942712 5:106345552-106345574 CAAAGGCACATCTTACATGGTGG - Intergenic
995392971 5:111659934-111659956 CACAGGCACATCTTACATGGTGG + Intergenic
995760983 5:115561675-115561697 AAAAGTCACATCTTACATGGTGG + Intergenic
995875190 5:116782533-116782555 CAGAGTTACATCTTACATGGTGG + Intergenic
996264623 5:121523074-121523096 CAAAGGAACATCTTACATGGCGG + Intergenic
996897783 5:128505059-128505081 CAGAATCACATCTTAAATGGCGG - Intronic
997036966 5:130203895-130203917 CAAAGTCACATCTTACATAGCGG + Intergenic
997387243 5:133483163-133483185 CAAAGGCACATCTTACATGGTGG - Intronic
997602082 5:135147481-135147503 CAAAGGCACATCTTACATGGCGG + Intronic
997730933 5:136175057-136175079 CAAAGTCATATCTTACATGGCGG + Intronic
998661020 5:144237763-144237785 GGGACTTATAACTTACATGGAGG - Intronic
999540246 5:152563639-152563661 CAAAGTCACATCTTACATGGTGG - Intergenic
999905968 5:156141621-156141643 CAGAGATACAAGATAAATGGGGG + Intronic
1000173158 5:158723821-158723843 GAGAATTACAACTTTCATGGGGG + Intronic
1000934504 5:167291994-167292016 CAAAGGCACATCTTACATGGCGG + Intronic
1001606856 5:172966840-172966862 CAGAGTCACATCGTACCTGGTGG + Intronic
1001860604 5:175051490-175051512 CAAAGTCACGTCTTACATGGTGG - Intergenic
1003352109 6:5327560-5327582 CAAAGGTATATCTTACATGGTGG - Intronic
1003635838 6:7830695-7830717 CAGAGGTACACCTTATATGGCGG + Intronic
1003931070 6:10925134-10925156 CAAAGTCACATCTTACATGGCGG + Intronic
1004181283 6:13382453-13382475 CAAAGTCACATCTTACATGGTGG - Intronic
1004731683 6:18365671-18365693 CAAAGGCACATCTTACATGGTGG - Intergenic
1004805577 6:19200842-19200864 GAAAGGTACATCTTACATGGTGG + Intergenic
1005084698 6:21993010-21993032 CACAGTTTTAACCTACATGGTGG - Intergenic
1005137831 6:22591489-22591511 CAAAGTTATGACTTACATGGCGG + Intergenic
1005329912 6:24739866-24739888 CAAAGGTACATCTTAAATGGTGG - Intergenic
1006875883 6:37295792-37295814 CAGAGTCATGTCTTACATGGTGG + Intronic
1006967250 6:38000497-38000519 CAGAGACACATCTTACATGGTGG + Intronic
1007343264 6:41207545-41207567 CAAAGGCACATCTTACATGGTGG + Intergenic
1007840060 6:44708814-44708836 CAAAATGACATCTTACATGGTGG + Intergenic
1008205175 6:48647104-48647126 CACAGTTAGAAATTACAAGGGGG + Intergenic
1008220726 6:48851306-48851328 CAAAGGCACATCTTACATGGTGG + Intergenic
1008317901 6:50069483-50069505 CAAAGCCACATCTTACATGGCGG - Intergenic
1008345214 6:50418423-50418445 AAGAGGTACATCTTACATGGTGG + Intergenic
1008347161 6:50441928-50441950 AAGAGGCACATCTTACATGGTGG - Intergenic
1008484856 6:52025047-52025069 AAGAATTTCAGCTTACATGGTGG - Exonic
1008689822 6:53965422-53965444 CAAAGTCACGTCTTACATGGTGG - Intronic
1009473505 6:64058175-64058197 CAAAGGCACATCTTACATGGTGG - Intronic
1009559323 6:65219789-65219811 AAAAGGTACATCTTACATGGCGG + Intronic
1009723600 6:67507371-67507393 CAAAGTCACATCTTACATGGTGG + Intergenic
1009897740 6:69774232-69774254 CAAAGTCACATCTAACATGGTGG - Intronic
1010367443 6:75067684-75067706 CAAAGCCACATCTTACATGGTGG - Intergenic
1010783799 6:79976177-79976199 CAAAGTTACATCTTACATGATGG - Intergenic
1011108176 6:83806026-83806048 CAAAGTCACATCTTACATGGTGG + Intergenic
1011263910 6:85496377-85496399 CAAAGGCACATCTTACATGGAGG + Intergenic
1011347831 6:86390775-86390797 CAAAGTTACATCTTATATGGTGG - Intergenic
1011754190 6:90482599-90482621 CAAAGTCACATCTTACATGGTGG - Intergenic
1011842062 6:91513844-91513866 CAAAGTCACATCTTACATGATGG + Intergenic
1011870329 6:91885281-91885303 CAAAGTCACATCTTTCATGGTGG - Intergenic
1011870595 6:91887228-91887250 CAAAGTCACATCTTAGATGGAGG - Intergenic
1012108513 6:95197282-95197304 CAAAGTCACATCTTACACGGTGG - Intergenic
1012165494 6:95945640-95945662 CAGAGTTTCAACAGTCATGGTGG + Intergenic
1012179997 6:96140632-96140654 CAAAGGCACATCTTACATGGTGG + Intronic
1012478344 6:99638700-99638722 CAAAGGCACATCTTACATGGTGG + Intergenic
1012644024 6:101657327-101657349 AAGAGGCACATCTTACATGGCGG - Intronic
1012644730 6:101664822-101664844 CAAAGGCACATCTTACATGGTGG + Intronic
1012741955 6:103028419-103028441 CAAAGTCACATCTTATATGGTGG + Intergenic
1012868667 6:104647106-104647128 CAAAGGCACATCTTACATGGTGG - Intergenic
1013425823 6:110011807-110011829 CAAAGGCACATCTTACATGGTGG - Intergenic
1013743795 6:113320629-113320651 CAAAGTCACATTTTACATGGAGG - Intergenic
1014143741 6:117972600-117972622 CAAAGACACATCTTACATGGTGG + Intronic
1014146497 6:118003858-118003880 CAGAGTTACTGCTCACATGAGGG + Intronic
1014476079 6:121873326-121873348 CAAAGTGACATCTTACATGGCGG + Intergenic
1014528023 6:122523829-122523851 CAAAGGCACATCTTACATGGCGG - Intronic
1014619424 6:123647303-123647325 CAAAGGCACATCTTACATGGTGG + Intergenic
1014625159 6:123715938-123715960 GAGAGTAACAACATATATGGTGG + Intergenic
1014626729 6:123735283-123735305 CAAAGCCACATCTTACATGGCGG - Intergenic
1014896772 6:126910841-126910863 CAAAGTCACATCTTACATGGCGG - Intergenic
1015045312 6:128769269-128769291 CAGAGGTACATCTTCCATGGTGG + Intergenic
1015061837 6:128975738-128975760 CAAAGTCACGTCTTACATGGTGG - Intronic
1015199835 6:130566762-130566784 CAAAGATACGTCTTACATGGTGG + Intergenic
1015688982 6:135899097-135899119 CAAAGTCACATCTTACATGATGG - Intronic
1015721608 6:136248488-136248510 CAAAGTCACATTTTACATGGTGG - Intronic
1015721717 6:136249735-136249757 CAAAGTCACATTTTACATGGTGG - Intronic
1015754185 6:136591095-136591117 CAAAGTCACATCTTACGTGGCGG - Intronic
1016079538 6:139838944-139838966 GAAAGTCACATCTTACATGGCGG - Intergenic
1016174625 6:141065384-141065406 CAAAGTAACATCTTGCATGGTGG + Intergenic
1016188311 6:141226289-141226311 CAGAGGCACATCTTACATGGTGG + Intergenic
1016306113 6:142685357-142685379 CAAAGTCACATCTTACATGGTGG + Intergenic
1016340539 6:143057575-143057597 CAAAGTCACATCTTACGTGGTGG - Intergenic
1016348302 6:143140093-143140115 CAAAGTCACGTCTTACATGGTGG + Intronic
1016494909 6:144650087-144650109 CAAAGGCACATCTTACATGGTGG + Intronic
1016529478 6:145042014-145042036 CAGAGTCATGTCTTACATGGAGG + Intergenic
1016554197 6:145316779-145316801 CAAAGTCACGTCTTACATGGTGG - Intergenic
1016587857 6:145709486-145709508 CAAAGTCATATCTTACATGGCGG - Intronic
1016757427 6:147702120-147702142 CAAAGGGACATCTTACATGGTGG + Intronic
1017341705 6:153331541-153331563 CAAAGGCACATCTTACATGGTGG - Intergenic
1017524376 6:155229836-155229858 CAAAGTCACATCTTACATGGCGG + Intronic
1017549728 6:155493226-155493248 CAAAGTCACATCTTACATGGTGG - Intergenic
1018229623 6:161663091-161663113 CAAAGTCACATCTTCCATGGCGG - Intronic
1018272633 6:162096687-162096709 CAAAGGCACATCTTACATGGCGG - Intronic
1018377307 6:163225415-163225437 AAGAGATACACCTTACATGGTGG - Intronic
1019088608 6:169504443-169504465 CAAAGTCACATCTTACATGGTGG - Intronic
1019394172 7:807951-807973 CAAAGTCACATCTTACATGGCGG - Intergenic
1019930432 7:4219445-4219467 CAAAGTCACATCTTACATGGTGG + Intronic
1019954791 7:4405076-4405098 CAAAGTCACGTCTTACATGGTGG + Intergenic
1020452612 7:8337169-8337191 CAGAGTTACAATTTCCATGCTGG + Intergenic
1020466454 7:8485240-8485262 CAAAGTCACATCTTACATGGAGG - Intronic
1020469980 7:8524788-8524810 AAAAGTCACATCTTACATGGTGG - Intronic
1020986911 7:15147382-15147404 CAAAGGGACATCTTACATGGTGG + Intergenic
1021124395 7:16834075-16834097 CTGAGATACAACTTACATCGGGG + Intergenic
1021754181 7:23834740-23834762 CAAAGGAACATCTTACATGGTGG - Intergenic
1022038759 7:26559348-26559370 CAAAGTCACGTCTTACATGGCGG + Intergenic
1022436873 7:30395609-30395631 CAAAGTCACCTCTTACATGGTGG - Intronic
1022874994 7:34519592-34519614 GAAAGTCACATCTTACATGGCGG + Intergenic
1022893573 7:34725963-34725985 CAAAGTCATATCTTACATGGCGG - Intronic
1022968632 7:35497229-35497251 CAAAGTCACGTCTTACATGGTGG + Intergenic
1023293201 7:38688651-38688673 CAAAGGCACATCTTACATGGTGG + Intergenic
1024220879 7:47285490-47285512 CAAAGGCACATCTTACATGGTGG - Intronic
1024413638 7:49078043-49078065 CAAAGACACATCTTACATGGTGG + Intergenic
1024413895 7:49079992-49080014 CAAAGGTACATCTTACATGGTGG + Intergenic
1024487038 7:49931058-49931080 CAAAGTCACATCTTACATGGTGG - Intronic
1024502732 7:50130337-50130359 CAAAGTTACGTCTTATATGGTGG + Intronic
1024684790 7:51733688-51733710 CAAAGTCACATCTTACATGATGG + Intergenic
1024685044 7:51735642-51735664 CAAAGGCACATCTTACATGGTGG + Intergenic
1026123586 7:67559444-67559466 CAAAGTCACATCTTACATGGTGG - Intergenic
1026141546 7:67711119-67711141 CAAAGTTACATCTTACGTGGTGG + Intergenic
1026180354 7:68034044-68034066 CAAAGGTACTTCTTACATGGTGG + Intergenic
1026341724 7:69440066-69440088 CAAAGCCACATCTTACATGGTGG + Intergenic
1026349042 7:69499668-69499690 CAAAGGCACATCTTACATGGTGG - Intergenic
1026454525 7:70559141-70559163 CAAAGGCACATCTTACATGGCGG - Intronic
1026573688 7:71554344-71554366 CAAAGTCACGTCTTACATGGTGG - Intronic
1027584663 7:80043825-80043847 CAAAGTTACATCTTACATGGTGG + Intergenic
1027733737 7:81906867-81906889 GAAAGGTACATCTTACATGGTGG - Intergenic
1027993415 7:85394344-85394366 CAAAGTAACATCTTACATGCTGG + Intergenic
1028176382 7:87664502-87664524 AAGAGTTACACCTTACATCATGG - Intronic
1029303226 7:99600564-99600586 CAGAGTCACATCTTTCATGGTGG + Intronic
1029804551 7:102982680-102982702 CAAAGGGACATCTTACATGGTGG - Intronic
1029846695 7:103419095-103419117 CAAAGTCACATCTTACATGGTGG - Intronic
1029965427 7:104735100-104735122 CAGACTGACACCTCACATGGCGG - Intronic
1030784623 7:113644789-113644811 CAAAGGCACATCTTACATGGTGG + Intergenic
1031186222 7:118482852-118482874 CAAAGGCACATCTTACATGGTGG + Intergenic
1031286115 7:119869930-119869952 AAGAGGCACATCTTACATGGTGG - Intergenic
1031341359 7:120606064-120606086 CAAAGGCACACCTTACATGGTGG - Intronic
1031614593 7:123865918-123865940 CAAAATCACATCTTACATGGTGG + Intronic
1031654241 7:124332549-124332571 CAAAGGCACATCTTACATGGTGG - Intergenic
1031803063 7:126273620-126273642 CAAAGGCACATCTTACATGGAGG + Intergenic
1031872269 7:127100618-127100640 CAAAGTCACGTCTTACATGGTGG + Intronic
1032486744 7:132293340-132293362 CACAATCACATCTTACATGGCGG + Intronic
1032534703 7:132653084-132653106 CAAAGTCATATCTTACATGGTGG - Intronic
1032696633 7:134342369-134342391 CAAAGTCACGTCTTACATGGAGG + Intergenic
1032764184 7:134975209-134975231 CAAAGTCACATCTTACGTGGTGG - Intergenic
1032962454 7:137052441-137052463 CAAAGTCACGTCTTACATGGTGG - Intergenic
1033136476 7:138788823-138788845 CAAAGGCACATCTTACATGGTGG - Intronic
1033487585 7:141806001-141806023 CAAAGTCACATCTTACATGATGG - Intergenic
1033641491 7:143266329-143266351 CAGAGTTAAGAATTCCATGGAGG - Intronic
1033898311 7:146103351-146103373 CAAAGTCACATCTTACCTGGTGG + Intergenic
1033905056 7:146192491-146192513 CAAAGTCACATCTTACATGGTGG + Intronic
1034012485 7:147544857-147544879 CAAAGAGACATCTTACATGGTGG - Intronic
1034012588 7:147545976-147545998 GAAAGTCACATCTTACATGGCGG - Intronic
1034090237 7:148357263-148357285 CAAAATCACATCTTACATGGTGG - Intronic
1034718499 7:153265450-153265472 CAAAGGCACATCTTACATGGTGG + Intergenic
1034786707 7:153933022-153933044 CAAAGATACATCTTACATGGCGG - Intronic
1034947015 7:155268818-155268840 CAAAGTCACATCTTACATGGTGG - Intergenic
1035117594 7:156537540-156537562 CAAAGTCACATCTTACATGGTGG - Intergenic
1035290553 7:157835388-157835410 CAGAGTTAAAATTCACATTGAGG + Intronic
1035674237 8:1443641-1443663 CAAAGTCACATCTTACATGGTGG + Intergenic
1035820321 8:2584347-2584369 CAAAGGCACATCTTACATGGTGG - Intergenic
1035979449 8:4353318-4353340 CAAAGTCACATCTTACATGGTGG - Intronic
1036196730 8:6723607-6723629 CAGAGTTAAAAGTGACATCGTGG - Intronic
1036414551 8:8535069-8535091 CAAAGGCACATCTTACATGGTGG + Intergenic
1036434476 8:8720660-8720682 CAAAGTCACATTTTACATGGTGG - Intergenic
1036525693 8:9532501-9532523 CAAAGTCACGTCTTACATGGTGG + Intergenic
1037019468 8:13951740-13951762 CAAAGTCACGTCTTACATGGTGG + Intergenic
1037182702 8:16026390-16026412 CAAAGTCACGTCTTACATGGAGG + Intergenic
1037263570 8:17035110-17035132 CAGAGTCACCTCTTACATGGCGG - Intronic
1037264716 8:17045783-17045805 CAAAGTCACATCTTACATGGAGG + Intronic
1037264932 8:17048379-17048401 CAAAATCACATCTTACATGGAGG + Intronic
1037394572 8:18428587-18428609 AAAAGTCACATCTTACATGGTGG - Intergenic
1037477908 8:19275784-19275806 CAAAGTCACATCTTACATGGCGG + Intergenic
1037494807 8:19428357-19428379 CAAAGTCACATCTTACGTGGCGG + Intronic
1037496211 8:19443530-19443552 CAAAGGCACATCTTACATGGTGG + Intronic
1037565644 8:20116045-20116067 CAAAGTCACATCTTACATGGTGG + Intergenic
1038002054 8:23400335-23400357 CAAAGGAACATCTTACATGGTGG + Intronic
1038094528 8:24293104-24293126 CAAAGACACATCTTACATGGAGG + Intergenic
1038289831 8:26239183-26239205 CAAAGTCACATCTTACATGGCGG + Intergenic
1038299109 8:26325362-26325384 GAAAGTTACCTCTTACATGGCGG - Intronic
1038741197 8:30218559-30218581 CAAAGTCACATCTTACATGGTGG - Intergenic
1038924517 8:32123393-32123415 CAAAGTCACATCTTACATGGTGG - Intronic
1038958702 8:32495333-32495355 CAAAGTCACGTCTTACATGGTGG - Intronic
1039021032 8:33206839-33206861 AAGAGGCACATCTTACATGGTGG + Intergenic
1039073462 8:33667162-33667184 CAAAATCACATCTTACATGGTGG + Intergenic
1039202819 8:35115704-35115726 CAGAGTTACAAGTTCCTTGACGG - Intergenic
1039209531 8:35196926-35196948 CAAAGTCACGTCTTACATGGTGG - Intergenic
1039342262 8:36663988-36664010 CAAAGACACATCTTACATGGTGG + Intergenic
1039427620 8:37499568-37499590 CAAAGTCACATCTTACAGGGAGG - Intergenic
1039584369 8:38693638-38693660 CAAAGGTACGTCTTACATGGTGG - Intergenic
1039684258 8:39780123-39780145 CAAAGGCACATCTTACATGGTGG + Intronic
1039910852 8:41825855-41825877 CAAAGGCACATCTTACATGGCGG - Intronic
1039938018 8:42064669-42064691 AAGAGTTAACACTTACATTGTGG - Intergenic
1040129607 8:43779578-43779600 CAGAGTTAAATCTTCCATTGAGG + Intergenic
1040762518 8:50867265-50867287 CAAAGTCACGTCTTACATGGTGG - Intergenic
1040973230 8:53160566-53160588 CAAAGGCACATCTTACATGGTGG - Intergenic
1041096884 8:54359412-54359434 CACAGGCACATCTTACATGGTGG - Intergenic
1041350461 8:56943109-56943131 CAAAGGAACATCTTACATGGTGG + Intergenic
1041631830 8:60097291-60097313 CAAAGTCACATCTTACATGGTGG + Intergenic
1042030806 8:64473367-64473389 CAAAGGTACATCTTACATGGCGG - Intergenic
1042073789 8:64966700-64966722 GAAAGTTACTTCTTACATGGTGG + Intergenic
1042218418 8:66450071-66450093 CAGAGTTAGAACTCACATCCAGG + Intronic
1042361933 8:67893602-67893624 CAAAGTCACGTCTTACATGGTGG + Intergenic
1042387037 8:68188640-68188662 CAAGGTCACATCTTACATGGAGG + Intronic
1042458598 8:69035864-69035886 TAGAGTGAAAACTTTCATGGTGG + Intergenic
1042826234 8:72982716-72982738 CAAAGGCACATCTTACATGGCGG - Intergenic
1043040318 8:75254187-75254209 CAAAGACACATCTTACATGGTGG + Intergenic
1043077216 8:75717320-75717342 CAAAGTCACATCTTACATGGCGG + Intergenic
1043206904 8:77455861-77455883 CAGAGCTGCAACAAACATGGGGG + Intergenic
1043275158 8:78384134-78384156 CAAAGTCACATCTTACATGGCGG - Intergenic
1043275422 8:78386102-78386124 TAAAATTACATCTTACATGGTGG - Intergenic
1043297324 8:78682435-78682457 CAAAGTCACATCTTACATGGCGG + Intronic
1043501816 8:80865916-80865938 TAGAGTTACAATTTATATGTAGG - Intronic
1043694936 8:83206269-83206291 CAGAAGTAAAACTTACTTGGTGG - Intergenic
1043794802 8:84522996-84523018 CAAAGGCACATCTTACATGGTGG + Intronic
1044125159 8:88451260-88451282 CAAAGGCACATCTTACATGGTGG + Intergenic
1044125425 8:88453259-88453281 CAAAGGGACATCTTACATGGAGG + Intergenic
1044504282 8:93000376-93000398 CAAAGGCACATCTTACATGGTGG + Intronic
1044530453 8:93301192-93301214 CAAAGGGACATCTTACATGGTGG - Intergenic
1044564957 8:93652832-93652854 CAAAGTTACGTCTTACATGGTGG - Intergenic
1044846659 8:96388667-96388689 CAAAGTCACATCTTACATGGTGG - Intergenic
1045160383 8:99535622-99535644 GTGAGTTACAACTTACATATAGG + Intronic
1045344802 8:101284341-101284363 CAGAGGCACATCTTACGTGGTGG + Intergenic
1045817892 8:106298311-106298333 CAAAGGCACATCTTACATGGAGG + Intronic
1046159458 8:110341538-110341560 CAAAGGCACATCTTACATGGTGG + Intergenic
1046473336 8:114708693-114708715 CAAAGGCACATCTTACATGGTGG + Intergenic
1046494456 8:114995741-114995763 CAAAGTCACATCTTACATGGTGG + Intergenic
1046504947 8:115125323-115125345 CAAAGTCACATCTTACATGGCGG + Intergenic
1046525243 8:115374830-115374852 CAAAGGCACATCTTACATGGTGG - Intergenic
1046686680 8:117235619-117235641 CAAAGTCACGTCTTACATGGTGG + Intergenic
1046710405 8:117505135-117505157 CAAAGTCACATCTTACATGATGG - Intergenic
1047153160 8:122287311-122287333 CAAAGGGACATCTTACATGGTGG + Intergenic
1047153890 8:122295554-122295576 CAAAGTCACATCTTACATGGTGG + Intergenic
1047258884 8:123238307-123238329 CAAAGTCACGTCTTACATGGCGG - Intronic
1047417654 8:124678510-124678532 CAAAGGTACGTCTTACATGGCGG + Intronic
1047642145 8:126832302-126832324 CAAAGGCACATCTTACATGGTGG + Intergenic
1047650268 8:126912945-126912967 CAAAGGTACGTCTTACATGGTGG - Intergenic
1048077884 8:131093519-131093541 CAAAGTCACGTCTTACATGGTGG + Intergenic
1048106429 8:131415372-131415394 CAAAGGTACATCTGACATGGTGG + Intergenic
1048112187 8:131480452-131480474 CAAAGGCACATCTTACATGGTGG + Intergenic
1048233766 8:132669817-132669839 CAGAGTTAAAAATTACAAGGAGG + Intronic
1048265481 8:132981756-132981778 CAGACTTCCAAATTACCTGGAGG - Intronic
1048363893 8:133721451-133721473 CAAAGTCACATCTTACATGGTGG - Intergenic
1048527514 8:135216617-135216639 CAAAGTCACATCTTACATGGTGG + Intergenic
1048681787 8:136850777-136850799 AAGAGGCACACCTTACATGGCGG + Intergenic
1048736797 8:137510977-137510999 CAAAGTCACATCTTACATGGTGG - Intergenic
1048773808 8:137923365-137923387 CAAAGGCACATCTTACATGGTGG + Intergenic
1049748295 8:144272225-144272247 CAGAGCTACAACTTCCAGGTGGG + Intronic
1050852694 9:10307505-10307527 TAGAGCTACAATATACATGGAGG + Intronic
1051017124 9:12491860-12491882 CGAAGTCACATCTTACATGGCGG - Intergenic
1051218284 9:14822113-14822135 CAAAGTCACGTCTTACATGGTGG - Intronic
1051423279 9:16909866-16909888 CAAAGATACGTCTTACATGGTGG - Intergenic
1051448051 9:17163066-17163088 CAAAGTCACATCTTACATTGTGG + Intronic
1051743742 9:20275821-20275843 CAAAGGCACATCTTACATGGTGG + Intergenic
1052219446 9:26001741-26001763 CAGGCTTAAAACCTACATGGTGG - Intergenic
1052518047 9:29509338-29509360 CGAAGTCACATCTTACATGGAGG + Intergenic
1052572362 9:30242638-30242660 AAGAGGCACATCTTACATGGTGG + Intergenic
1052686386 9:31763584-31763606 CAAAGTCACATCTTACATGGTGG + Intergenic
1053544737 9:39011170-39011192 CAATGTTAAAACTTATATGGAGG + Intergenic
1053809176 9:41834650-41834672 CAATGTTAAAACTTATATGGAGG + Intergenic
1054621416 9:67352778-67352800 CAATGTTAAAACTTATATGGAGG - Intergenic
1054794693 9:69289529-69289551 CAAAGTCACATCTTACACGGCGG - Intergenic
1055111606 9:72565737-72565759 CAAAGGCACATCTTACATGGTGG + Intronic
1055380440 9:75700887-75700909 CCAAGTTATAATTTACATGGAGG + Intergenic
1055520943 9:77080564-77080586 CAGAGTTAGATCTTCCATGATGG - Intergenic
1055560396 9:77516369-77516391 CAGAGATACCACTCACTTGGAGG + Intronic
1055578504 9:77683560-77683582 CAAAGGCACATCTTACATGGTGG + Intergenic
1055998673 9:82190943-82190965 CAAAGGGACATCTTACATGGCGG - Intergenic
1056064326 9:82917397-82917419 CAAAGGGACATCTTACATGGTGG + Intergenic
1056689627 9:88796252-88796274 TAAAGTCACATCTTACATGGTGG + Intergenic
1056805652 9:89726783-89726805 CAAAGTCACATCTTAGATGGCGG + Intergenic
1056847805 9:90055740-90055762 CAAAATCACATCTTACATGGTGG - Intergenic
1056906399 9:90653301-90653323 CAAAGTCACATCTTACCTGGTGG + Intergenic
1057480184 9:95439206-95439228 CACAGCTTCCACTTACATGGCGG - Intergenic
1057491528 9:95523608-95523630 CAAAGTCACATCTTACATGGTGG - Intergenic
1057560007 9:96119930-96119952 CAAAGGCACATCTTACATGGCGG + Intergenic
1058193581 9:101947561-101947583 CAAAGGCACATCTTACATGGTGG - Intergenic
1058222102 9:102314905-102314927 CAAAGCTACATTTTACATGGTGG - Intergenic
1058513814 9:105749359-105749381 CAAAGGCACATCTTACATGGTGG + Intronic
1058551237 9:106117272-106117294 CAAAATCACATCTTACATGGTGG - Intergenic
1058809889 9:108629391-108629413 CAAAGGCACATCTTACATGGTGG - Intergenic
1058892824 9:109375367-109375389 CAAAGTCACGTCTTACATGGTGG - Intergenic
1058960541 9:109988974-109988996 CAAAGGCACATCTTACATGGAGG - Intronic
1058961374 9:109995563-109995585 CAAAGTCACATCTTACATGGCGG + Intronic
1059050028 9:110914344-110914366 AAAAGGTACATCTTACATGGCGG + Intronic
1059069358 9:111119594-111119616 CAAAGGCACATCTTACATGGTGG + Intergenic
1059601294 9:115782337-115782359 CAAAGGCACATCTTACATGGTGG - Intergenic
1059628185 9:116090659-116090681 CAAAGTCACATCTTACATGGCGG - Intergenic
1059878063 9:118658311-118658333 TAAAGTCACATCTTACATGGTGG - Intergenic
1060021090 9:120131936-120131958 CAAAGTCACATCTTACACGGTGG + Intergenic
1060058099 9:120433238-120433260 CAAAGTCACAACTGACTTGGCGG - Intronic
1060254066 9:122011171-122011193 AAAAGGTACATCTTACATGGTGG - Intronic
1060312391 9:122474003-122474025 CTGAGTTTCAACTTACCTGGAGG - Intergenic
1061436026 9:130562680-130562702 CAAAGTCACGTCTTACATGGTGG + Intergenic
1061891990 9:133627029-133627051 CAAAGTCACATCTTACATGGCGG + Intergenic
1062210867 9:135363144-135363166 CAGAGGCACATCTTACATGGCGG - Intergenic
1062632743 9:137473041-137473063 CAGAGGCACATCTTACATGGTGG + Intronic
1203659447 Un_KI270753v1:27925-27947 CAGAGATAAAACTGACCTGGAGG + Intergenic
1185451781 X:284830-284852 CAAAGTCACATGTTACATGGTGG + Intronic
1185474920 X:409418-409440 CAAAGTCACATCTTACATGGCGG - Intergenic
1185673546 X:1830713-1830735 CAAAGCCACACCTTACATGGCGG + Intergenic
1185797609 X:2980407-2980429 GAAAGTCACATCTTACATGGTGG - Intergenic
1185799913 X:3001212-3001234 CAAAGGCACATCTTACATGGAGG - Intergenic
1185846669 X:3443784-3443806 CAAAGGCACATCTTACATGGTGG + Intergenic
1185856641 X:3542437-3542459 CAAAGTCACATCTTACATGGTGG + Intergenic
1185890863 X:3820756-3820778 CAAAGTCACGTCTTACATGGTGG + Intronic
1185952852 X:4455620-4455642 CAAAGTCACATCTTACATGGTGG - Intergenic
1185986393 X:4839322-4839344 CAAAGGCACATCTTACATGGTGG + Intergenic
1186039457 X:5460379-5460401 CAAAGGCACATCTTACATGGTGG + Intergenic
1186060059 X:5695377-5695399 CAAAGTCACATCTTACTTGGTGG + Intergenic
1186079435 X:5913945-5913967 CAAAGTCACATCTTACATGGTGG - Intronic
1186125972 X:6414278-6414300 CAAAGGCACATCTTACATGGCGG - Intergenic
1186134198 X:6502001-6502023 CAAAGTCACGTCTTACATGGTGG + Intergenic
1186270150 X:7878183-7878205 CAAAGGCACATCTTACATGGTGG - Intergenic
1186306432 X:8264711-8264733 CAGAGGCACGTCTTACATGGTGG + Intergenic
1186686639 X:11931523-11931545 CAGTGTGACTTCTTACATGGTGG + Intergenic
1187046622 X:15653679-15653701 CACAGTTGCATCTGACATGGTGG + Intronic
1187214534 X:17263847-17263869 TAAAGTCACATCTTACATGGTGG - Intergenic
1187214819 X:17265722-17265744 CAAAGCCACATCTTACATGGTGG - Intergenic
1187279488 X:17847010-17847032 CAAAGGGACATCTTACATGGTGG - Intronic
1187283465 X:17880863-17880885 CAAAGTCACGTCTTACATGGTGG + Intergenic
1187301044 X:18050179-18050201 CAAAGTCACATCTTACATGGTGG - Intergenic
1187626204 X:21116975-21116997 CAAAGACACATCTTACATGGTGG + Intergenic
1187973606 X:24683264-24683286 CAAAGTCACATCTTACGTGGTGG + Intergenic
1188055902 X:25541141-25541163 CAAAGGTACATCTTACATGGCGG + Intergenic
1188134758 X:26482495-26482517 CAAAGGCACATCTTACATGGTGG - Intergenic
1188169789 X:26910786-26910808 CAAAGTCACATCTTACATGGTGG - Intergenic
1188261084 X:28024921-28024943 CAAAGTCACGTCTTACATGGTGG - Intergenic
1188352748 X:29152099-29152121 CAAAGTCACGTCTTACATGGTGG + Intronic
1188447692 X:30273379-30273401 CGAAGTCACATCTTACATGGTGG - Intergenic
1189137801 X:38567330-38567352 CAAAGTTACATCTTACATGGTGG + Intronic
1189423613 X:40879317-40879339 CAAAGTCACATCTTACATTGTGG + Intergenic
1189679206 X:43497526-43497548 CAAAGTCACATCTTACATGGTGG - Intergenic
1189880997 X:45492110-45492132 CAAAGGTACATCTTACATGGTGG + Intergenic
1190086127 X:47396856-47396878 CAAAGTCACATCTTACATGGTGG + Intronic
1190514166 X:51206050-51206072 CAAAGTCACATCTTACATGGTGG - Intergenic
1190721693 X:53154095-53154117 CAAAGTCACATCTTACATAGTGG + Intergenic
1190974388 X:55385538-55385560 CAAAGGCACATCTTACATGGTGG - Intergenic
1191674412 X:63779383-63779405 CACAGGCACATCTTACATGGTGG + Intronic
1191892977 X:65963724-65963746 CAAAGTCACATCTTACATGGTGG + Intergenic
1193199116 X:78666694-78666716 CAAAGTCACATCTTACATGGTGG - Intergenic
1193250075 X:79280846-79280868 CAAAGTCACGTCTTACATGGTGG + Intergenic
1193250321 X:79282808-79282830 CAAAGTCACATCTTACATTGCGG + Intergenic
1193541963 X:82783030-82783052 CAATGTCACATCTTACATGGTGG + Intergenic
1193620413 X:83746585-83746607 CAAAACTACATCTTACATGGTGG - Intergenic
1193978314 X:88150591-88150613 CAAAGGCACATCTTACATGGCGG - Intergenic
1194372096 X:93086889-93086911 CAAAGCCACATCTTACATGGTGG + Intergenic
1194463197 X:94197756-94197778 CAAAGTGACATCTCACATGGTGG - Intergenic
1194678806 X:96826588-96826610 CACATATTCAACTTACATGGTGG - Intronic
1194886257 X:99319209-99319231 CAAAGGCACATCTTACATGGTGG - Intergenic
1195154672 X:102110823-102110845 AAAAGTTACATCTTACATGGTGG - Intergenic
1195987384 X:110645398-110645420 CAGACTGACACCTCACATGGCGG - Intergenic
1196066443 X:111469698-111469720 CAAAGGCACATCTTACATGGTGG - Intergenic
1196148390 X:112344894-112344916 CAGACTTACATCTTACATGGCGG + Intergenic
1196548581 X:116995407-116995429 CAAAGGCACATCTTACATGGTGG + Intergenic
1196973734 X:121137008-121137030 TAAAGTTACTTCTTACATGGTGG + Intergenic
1197442973 X:126512937-126512959 CAAAGGCACATCTTACATGGCGG + Intergenic
1197531738 X:127637051-127637073 CAAAGGTCCATCTTACATGGTGG + Intergenic
1197578647 X:128255167-128255189 CAAAGTCATATCTTACATGGTGG + Intergenic
1197878131 X:131133462-131133484 CAAAGTCACAACTTACATGGTGG + Intergenic
1198031030 X:132753540-132753562 CAAAGTCACACCTTACATGGTGG - Intronic
1198044548 X:132888298-132888320 CAAAGGGACATCTTACATGGTGG + Intronic
1198164111 X:134036460-134036482 CAAAGTCACATCTTACATGGTGG - Intergenic
1198590430 X:138174572-138174594 CAAAGTCACGTCTTACATGGTGG + Intergenic
1198600338 X:138277616-138277638 CAAAGTCACATCTTACATGGTGG - Intergenic
1198612472 X:138417432-138417454 CAAAGTCACGTCTTACATGGTGG - Intergenic
1198796894 X:140406793-140406815 CAAAGTCACATCTTACATGGTGG - Intergenic
1198860168 X:141060576-141060598 CAAAGGGACATCTTACATGGTGG - Intergenic
1198902523 X:141526814-141526836 CAAAGGGACATCTTACATGGTGG + Intergenic
1198912706 X:141632652-141632674 CAAAATCACATCTTACATGGAGG - Intronic
1198941855 X:141965009-141965031 CAAAGTCACTTCTTACATGGCGG + Intergenic
1198967023 X:142237919-142237941 CAAAGTCACATCTTACATGGTGG - Intergenic
1199006879 X:142710084-142710106 GAAAGTTACATCTTACATGGTGG - Intergenic
1199043109 X:143138220-143138242 CAAAGTCTCATCTTACATGGTGG - Intergenic
1199048255 X:143203455-143203477 CAAAGGTACATCTTACTTGGTGG + Intergenic
1199182618 X:144876492-144876514 CAAAGTCACGTCTTACATGGCGG + Intergenic
1199192196 X:144982809-144982831 CAATGGTACATCTTACATGGCGG - Intergenic
1199203979 X:145125506-145125528 CAAAGGCACATCTTACATGGCGG + Intergenic
1199222975 X:145339203-145339225 CAAAGTCACGTCTTACATGGAGG + Intergenic
1199275864 X:145941103-145941125 CAAAGTCACATCTTACATGGTGG - Intergenic
1199313600 X:146350154-146350176 CAGAGTTACCATTTGCATGGTGG + Intergenic
1199375673 X:147105465-147105487 CAAAGTCACATCTTACATGGTGG - Intergenic
1199509635 X:148607469-148607491 CAAAGGCACATCTTACATGGTGG - Intronic
1199525880 X:148791294-148791316 CAAAGTCACATCTAACATGGTGG + Intronic
1199580922 X:149358929-149358951 CAAAGGCACATCTTACATGGTGG - Intergenic
1199869921 X:151889069-151889091 CAAAGTCACATCTTAAATGGTGG - Intergenic
1199909251 X:152268419-152268441 CAAAGGGACATCTTACATGGTGG - Intronic
1199928673 X:152495896-152495918 CAAAGTCACATCTTACATGATGG + Intergenic
1200050542 X:153427991-153428013 CAAAGTCACATCTTACATGGTGG + Intergenic
1200346106 X:155451057-155451079 CAAAGGCACATCTTACATGGTGG - Intergenic
1200380587 X:155833517-155833539 CAAAGTCACATCTTACATGGCGG - Intergenic
1200680148 Y:6200931-6200953 CAAAGCCACATCTTACATGGTGG + Intergenic
1200764031 Y:7065328-7065350 CAAAGTTATGCCTTACATGGTGG - Intronic
1200784154 Y:7244507-7244529 AAAAGTCACATCTTACATGGTGG - Intergenic
1200817489 Y:7548623-7548645 CAAAGTCACATCTTACATGGTGG + Intergenic
1201502777 Y:14663318-14663340 CAGAATTGCAACAAACATGGGGG + Intronic
1201547505 Y:15181637-15181659 CAAAGGCACATCTTACATGGTGG - Intergenic
1201617550 Y:15918445-15918467 GAAAGTCACATCTTACATGGTGG + Intergenic
1201894392 Y:18978218-18978240 CAAAGTTATATCTTACTTGGTGG - Intergenic
1201912319 Y:19145398-19145420 CAAAGGTACATTTTACATGGTGG - Intergenic