ID: 975875745

View in Genome Browser
Species Human (GRCh38)
Location 4:78834986-78835008
Sequence ATGCTAGAATTCAGGAAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 327
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 298}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975875745 Original CRISPR ATGCTAGAATTCAGGAAAAT GGG (reversed) Intronic
902138280 1:14329859-14329881 ATGCTAGAAGTGAAGAAAACAGG - Intergenic
905141620 1:35850245-35850267 ATGCAGGAATTCAGGTAATTTGG + Exonic
907066651 1:51490935-51490957 ATGTTACAATTAGGGAAAATTGG + Intronic
907691691 1:56673503-56673525 AGAATAGAATTGAGGAAAATGGG + Intronic
908136012 1:61133596-61133618 AGACTAGAATTCAGAAAACTTGG + Intronic
908485468 1:64588097-64588119 GTGATATAAATCAGGAAAATAGG - Intronic
910028162 1:82683145-82683167 TCTCTAGGATTCAGGAAAATAGG - Intergenic
911404494 1:97419906-97419928 ATGCGAGAATAAAGGAAAATAGG - Intronic
912091209 1:106078742-106078764 TTGTTAGCATTCAGAAAAATTGG - Intergenic
912446742 1:109742140-109742162 ATGGTTGAATTTAGGAAAGTAGG + Intronic
915067202 1:153235078-153235100 ATGCTAGTATTAATGAAAATTGG + Intergenic
915516001 1:156413067-156413089 ATGGTAGAAGCCAGGAAAAAAGG - Intronic
915710753 1:157895866-157895888 ATGTTACAATTGAGGAAAACTGG - Intronic
916231363 1:162544410-162544432 GTGGTAGTATTCAGAAAAATGGG + Intergenic
916590494 1:166185483-166185505 ATGCACGAATGCAGGAAGATGGG - Intergenic
916631616 1:166620568-166620590 ATGATAGAAGTCAGAAAAACTGG - Intergenic
919835512 1:201570496-201570518 ATGCGAGAATAGAGGATAATAGG + Intergenic
920544916 1:206808449-206808471 AGGATAGAATTCAGAAAATTAGG + Intronic
921372732 1:214441504-214441526 ATGCTGATATTCAGGAAAAAAGG + Intronic
923918215 1:238533047-238533069 TTGCAAGAATATAGGAAAATTGG - Intergenic
924061430 1:240178866-240178888 ATGTTACCATTTAGGAAAATCGG - Intronic
924655011 1:245966468-245966490 ATGCTAGAAAATAGCAAAATTGG - Intronic
1063001653 10:1929899-1929921 CTGCTAGAATGAAGGAAAAATGG + Intergenic
1063476436 10:6332783-6332805 ATGCTAGCCTGCAGGTAAATAGG - Intergenic
1065328052 10:24567969-24567991 TTGATGGAATTCATGAAAATAGG + Intergenic
1068166468 10:53338536-53338558 CTGCTATAATTCAAAAAAATTGG - Intergenic
1069189776 10:65471967-65471989 AAGGTAAAATTCAGGAAACTGGG + Intergenic
1070732538 10:78841287-78841309 AAGCTAGAATTAAGGAAGAAGGG + Intergenic
1071094242 10:81954766-81954788 ATGCCAAAATCCAGGAAAAGAGG + Intronic
1071696367 10:87877932-87877954 ATACTACAAGCCAGGAAAATTGG - Intronic
1072551433 10:96480491-96480513 ATGCTAGAAGTCAAGAAAAATGG + Intronic
1074679013 10:115884044-115884066 ATGCTAGAGCTGAGGAAAAATGG + Intronic
1074782132 10:116809655-116809677 CTCCTGGGATTCAGGAAAATTGG + Intergenic
1075309631 10:121402633-121402655 ATGTTACCATTGAGGAAAATTGG + Intergenic
1075503194 10:122997139-122997161 ATGCTCATAATCAGGAAAATCGG + Intronic
1076341288 10:129747566-129747588 ATGGTATAATTTGGGAAAATAGG - Intronic
1077697798 11:4410789-4410811 ATGTTAACATTAAGGAAAATGGG + Intergenic
1079067474 11:17308571-17308593 CTTCTAGAATTGAGCAAAATGGG - Intronic
1079596033 11:22247776-22247798 ATGCTAAGATTGAGAAAAATGGG + Intronic
1080177030 11:29376965-29376987 ATTCTAGATTTCAGGATAAAAGG - Intergenic
1081069072 11:38586726-38586748 ATGCTGGATTTCAAGTAAATAGG + Intergenic
1084130321 11:67128891-67128913 ATCCTAGCATTCAAGAAAATTGG - Intronic
1084967781 11:72753385-72753407 ATTCTAGAACTCATAAAAATGGG - Intronic
1085231307 11:74973422-74973444 ATGATAGAAAACAGGATAATGGG - Intronic
1085823210 11:79815286-79815308 ATGTTGGAATACATGAAAATTGG - Intergenic
1085834903 11:79943041-79943063 ATGGTAGAATTCATGAAACGAGG + Intergenic
1087259601 11:95995784-95995806 ATGATAGAAGTGAGGAAAATGGG - Intronic
1087643620 11:100782705-100782727 AGGATAGAATTCAGGATAGTTGG + Intronic
1087721969 11:101676591-101676613 AGGACGGAATTCAGGAAAATAGG + Intronic
1087984176 11:104657015-104657037 ATGGAAGAATTCAGGAAAATAGG - Intergenic
1092277643 12:7074112-7074134 ATGCTTCCATTCAGGAAACTAGG - Intergenic
1092679976 12:10968499-10968521 GTGCTACAATTCAGGGTAATGGG + Intronic
1092683092 12:11010375-11010397 GTGCTGGAATTCAGGGCAATGGG + Intronic
1093186403 12:16023969-16023991 ATGCTAGAAATCAGAAACACTGG + Intronic
1095390420 12:41699518-41699540 ATGCTGGAATTCATAAAAAAAGG + Intergenic
1096933832 12:55246670-55246692 ATTCAAGTTTTCAGGAAAATTGG + Intergenic
1097467261 12:59942803-59942825 ATGAAAGAGTTCAGGAAAAGTGG + Intergenic
1098081704 12:66793074-66793096 AATCTAGAATTCATGAGAATTGG - Intronic
1098722508 12:73918877-73918899 ATGCTAGAAGTTAGGGTAATGGG - Intergenic
1099791128 12:87335273-87335295 TTCCTAAAATTCAGGAAAAATGG + Intergenic
1100829465 12:98504390-98504412 ATTCTAACATTCAAGAAAATTGG - Intergenic
1101024979 12:100592980-100593002 ATGATAGAAAAGAGGAAAATAGG + Intronic
1101450753 12:104776542-104776564 AGACTAGAATGCAGGAAAAATGG - Intergenic
1101589074 12:106110503-106110525 ATGTGAGAATTGAGGAAAACTGG - Intronic
1102915967 12:116752361-116752383 ATGCCAGAATTCAGGGTAGTGGG - Intronic
1102925108 12:116820547-116820569 ATGATAAAATTCAGAATAATGGG - Intronic
1105546801 13:21356470-21356492 ATGCTGAAATTCATGAAAAGGGG + Intergenic
1106201267 13:27539156-27539178 AGGCTAGCAGTCAGGAGAATGGG + Intergenic
1106711327 13:32337113-32337135 ATGGTAGAGTTCTTGAAAATGGG - Exonic
1107287025 13:38804967-38804989 ATGCTTCAAATGAGGAAAATTGG - Intronic
1107468219 13:40667437-40667459 ATGCTAGAAATGAGGAACAGGGG + Intergenic
1108557169 13:51605037-51605059 ATGCAATATTGCAGGAAAATAGG + Intronic
1108995459 13:56728463-56728485 TTGCTTTATTTCAGGAAAATTGG + Intergenic
1109135093 13:58638905-58638927 ATGCTGCTATTCAGGCAAATTGG - Intergenic
1109149021 13:58821125-58821147 ATGTTAGAAAACAGGAAATTTGG - Intergenic
1109260964 13:60144582-60144604 ATTCTAGAATTCTGGGAAAATGG - Intronic
1109349985 13:61167246-61167268 ATTGTAGAATTTAGGAAAAGAGG - Intergenic
1109454399 13:62565561-62565583 ATTCTAAAATTCATGAAAATGGG + Intergenic
1109895006 13:68675435-68675457 ATGAAATAAATCAGGAAAATTGG + Intergenic
1110116073 13:71818239-71818261 ATGCTATAATTAGGGAAAACAGG + Intronic
1111070208 13:83156371-83156393 ATGATACAATTCAGGAGACTAGG - Intergenic
1111226229 13:85274707-85274729 ATGCTAGCATCCATGAAACTGGG - Intergenic
1113228929 13:108191061-108191083 ATGCTGGAAGTAAAGAAAATAGG + Intergenic
1113266021 13:108618999-108619021 ATAATAGAAATCAGGCAAATGGG - Intronic
1113743960 13:112729960-112729982 AAGCTTGAACTTAGGAAAATGGG + Intronic
1115741282 14:36391579-36391601 ATGCTATAACAAAGGAAAATTGG - Intergenic
1116922889 14:50599423-50599445 AAGCTAGGATTTGGGAAAATGGG + Intronic
1119202252 14:72764789-72764811 TTGCTGGAACTCAGGAAAACAGG - Intronic
1119649182 14:76371640-76371662 AAGCTTGGCTTCAGGAAAATGGG + Intronic
1120470722 14:84920362-84920384 ATGAAAGAAAACAGGAAAATAGG - Intergenic
1120895973 14:89532972-89532994 ATGCCAGAATTCAACAAAAATGG + Intronic
1121672518 14:95723802-95723824 GTGCTAATATTCAGTAAAATGGG + Intergenic
1122386721 14:101353404-101353426 ATGTAAGAATTCAGGAAATATGG - Intergenic
1125042028 15:35199599-35199621 ATTCTAGAAGTCAAGAAATTTGG - Intergenic
1125305005 15:38301847-38301869 AAACTAGAACTCAGGAAAATGGG - Intronic
1125345133 15:38711671-38711693 CTGCTAGAACTCAGTATAATAGG + Intergenic
1129930859 15:79409872-79409894 ATTTTACAGTTCAGGAAAATTGG - Intronic
1130669689 15:85900501-85900523 AGGCTTGAACTCAGGACAATGGG + Intergenic
1130887764 15:88108376-88108398 AGGCCAGAAGTGAGGAAAATAGG - Intronic
1131209496 15:90481531-90481553 ATGCTTGAACTCAGGAAAAAAGG - Intronic
1131306823 15:91252398-91252420 AGACAAGAATTCAGAAAAATAGG - Exonic
1131812921 15:96191320-96191342 AGGCCAGAATTCAGTCAAATGGG + Intergenic
1131896124 15:97031759-97031781 ATGATAAAACTCAGAAAAATAGG + Intergenic
1133671578 16:8027050-8027072 ATGTTAGAATTCTGGAATAATGG + Intergenic
1136549774 16:30976757-30976779 ATGCAAGAATCCAGGTAAACAGG + Intronic
1137938051 16:52654419-52654441 ATGCACAAATTCAGGAAGATTGG - Intergenic
1139026089 16:62819897-62819919 ATTCTATATATCAGGAAAATAGG + Intergenic
1139687741 16:68617397-68617419 ATGCTTGAAATCAGGATTATGGG - Intergenic
1139768179 16:69250345-69250367 AAGATAGAATTTAGGAAGATAGG + Intronic
1140951208 16:79819365-79819387 TAGCTACAATTCAGAAAAATTGG + Intergenic
1141039166 16:80656526-80656548 ATGCTACATATCTGGAAAATAGG + Intronic
1145031543 17:19508075-19508097 GTGCTGGAATTCAGGAAAGAGGG + Intronic
1146768948 17:35550745-35550767 ATTATAGAATTCAGCAAAAGAGG - Intronic
1147497122 17:40927288-40927310 ATAGTAGAATGCATGAAAATGGG + Intronic
1147807002 17:43138881-43138903 ATGGAAGAAGTCAGGAAACTTGG - Intergenic
1148168953 17:45503485-45503507 ATGGAAGAAGTCAGGAAACTTGG - Intergenic
1148279864 17:46339528-46339550 ATGGAAGAAGTCAGGAAACTTGG + Exonic
1148302082 17:46557384-46557406 ATGGAAGAAGTCAGGAAACTTGG + Exonic
1148502877 17:48105072-48105094 ATGCCAGAATTAGGGAAAATAGG - Intronic
1150400147 17:64849946-64849968 ATGGAAGAAGTCAGGAAACTTGG - Intergenic
1151065062 17:71139352-71139374 ATTATAGGATTCAGAAAAATAGG + Intergenic
1151065300 17:71142304-71142326 AAGTTACAATTCAGGAAAAATGG - Intergenic
1153095067 18:1391721-1391743 CCTCTAGAATTCAGGAAATTAGG - Intergenic
1153106057 18:1528362-1528384 AGACTAGAATTGAAGAAAATTGG - Intergenic
1153271480 18:3326884-3326906 ATGATAGAAGTCAGGAAGAGTGG + Intergenic
1153897360 18:9578219-9578241 ATGCTAAACTTCAGGGAAATTGG - Intronic
1154092261 18:11376615-11376637 ATGCTGGAATTGAAGAAAACTGG - Intergenic
1155474310 18:26222762-26222784 ATAATATAATTCAAGAAAATTGG + Intergenic
1155538833 18:26845433-26845455 ATGATAGAATTGAAGAGAATTGG + Intergenic
1155827615 18:30467778-30467800 CTCCTAGAATTCTGGAAACTAGG + Intergenic
1156183836 18:34638736-34638758 ATTCCACTATTCAGGAAAATAGG + Intronic
1156536248 18:37867347-37867369 AGGGTAAAATTCAGGAAAATAGG + Intergenic
1157056034 18:44229992-44230014 ATGCTAGAGCACAGGAAACTTGG + Intergenic
1157898388 18:51490045-51490067 ATGCTAAAAGGCATGAAAATTGG + Intergenic
1158011109 18:52729000-52729022 AGGGTCAAATTCAGGAAAATCGG + Intronic
1158197084 18:54900134-54900156 GTGGTAGAATTATGGAAAATTGG - Intergenic
1158245022 18:55422663-55422685 ATGCTTGCATTATGGAAAATCGG - Intronic
1161754797 19:6124516-6124538 GTGGTAGAAGTCAGAAAAATGGG - Intronic
1165820442 19:38671599-38671621 TTGATGGATTTCAGGAAAATGGG + Intronic
1166034053 19:40154487-40154509 CCACAAGAATTCAGGAAAATGGG - Intergenic
1167438287 19:49492774-49492796 CTGCTAGACATCAGTAAAATGGG - Intergenic
1168078274 19:53992107-53992129 TCGCTGGAATTCAGGAAAAGGGG - Intergenic
925690456 2:6517601-6517623 ATGAATAAATTCAGGAAAATGGG - Intergenic
926629427 2:15123281-15123303 ATGCTAGAAAGCAGGAAATGGGG - Intergenic
927909977 2:26890532-26890554 AAGCTGGAATTCAGCACAATTGG + Intronic
930259612 2:49129886-49129908 ATGTTTGAGTTCAGGAAATTAGG + Intronic
930899932 2:56493652-56493674 ATGGTAGAACTCAAGTAAATGGG + Intergenic
930943841 2:57047198-57047220 AATCTAGAATTCAGAAGAATGGG - Intergenic
931073833 2:58686507-58686529 ATGCTTGGATTTAGGAAAATAGG + Intergenic
932505317 2:72224146-72224168 TTGCTAGTAATCAGGGAAATAGG + Intronic
933333796 2:80928632-80928654 TTGTCAGAACTCAGGAAAATAGG + Intergenic
936631829 2:114211702-114211724 AAACTTGAATTCAGGAAAAAAGG + Intergenic
936740364 2:115498590-115498612 AGGCTAGAATTGGGTAAAATTGG + Intronic
938946290 2:136215001-136215023 ATGATGGATTTCTGGAAAATTGG + Intergenic
939753722 2:146083204-146083226 ATGTTAGAATTAAGTAACATAGG - Intergenic
939814082 2:146872351-146872373 ATTCTAGACTTCCTGAAAATTGG + Intergenic
939981543 2:148788310-148788332 ATGCTTTACTTCAGTAAAATGGG - Intergenic
941195379 2:162444201-162444223 ATTCTAGAATTGAGGAAGAGGGG - Intronic
942148789 2:173054169-173054191 ATGCTAGCTTTCAGTAAAGTAGG - Intergenic
942711676 2:178843203-178843225 TGGCTAAAATTCAGGAGAATTGG + Intronic
942966344 2:181897395-181897417 TTTCTAAAAATCAGGAAAATGGG - Intronic
942974831 2:182003439-182003461 ATGCAAGTATTTAGTAAAATAGG - Intronic
943341431 2:186686598-186686620 TTGCTATGCTTCAGGAAAATGGG - Intergenic
943342267 2:186694706-186694728 AGGGTAGAATTCAGGAAGAAGGG - Intronic
943816526 2:192264145-192264167 TTGTTACATTTCAGGAAAATAGG - Intergenic
944203208 2:197130744-197130766 ATGCTAGTAGACAGGAGAATTGG - Intronic
945166056 2:206947547-206947569 AAGCTAGACTTCATTAAAATTGG + Intronic
946890083 2:224266137-224266159 ATGCTAACATTGAGGAAAGTTGG + Intergenic
947061645 2:226172924-226172946 CTGATAGATTCCAGGAAAATAGG + Intergenic
947183034 2:227429026-227429048 ATGCTAGGATTCAGAATCATAGG + Intergenic
1169184289 20:3600771-3600793 TTGCTTGTATTAAGGAAAATTGG + Intronic
1169984223 20:11423739-11423761 CTGCTAGAAGTCAGGAAAGTGGG - Intergenic
1170399060 20:15960378-15960400 AGGCTAGAAGTCAGGAGAATAGG + Intronic
1170707174 20:18754739-18754761 ATTCTATAGTTCAAGAAAATAGG + Intronic
1172817814 20:37702977-37702999 ATGTCAGACTTCAAGAAAATTGG + Intronic
1173038465 20:39435692-39435714 ATGCTATCATTGAGGAAACTGGG - Intergenic
1174792540 20:53493876-53493898 AAGCTAATATTCAGGATAATGGG - Exonic
1175033223 20:55975336-55975358 ATGCAAGAAGTCAAGAAAAAGGG - Intergenic
1177015853 21:15786033-15786055 ATTCTAGAATATAGGAAAAATGG + Intronic
1177610235 21:23436577-23436599 ATGATGGAATACAGGAAGATGGG + Intergenic
1177759791 21:25390483-25390505 TTTATAGAATCCAGGAAAATGGG - Intergenic
1177808327 21:25897918-25897940 ATGCTATAATTTTTGAAAATGGG + Intronic
1179100259 21:38350394-38350416 AAGCTGGAAATGAGGAAAATGGG + Intergenic
952285755 3:31967875-31967897 AGACTAGAATTAAGGCAAATTGG + Intronic
955260331 3:57382994-57383016 ATACTAGAATTCAGACAAATGGG + Intronic
955365071 3:58303883-58303905 ATGAGAGAATTCAGGCAACTGGG + Intergenic
955646815 3:61148383-61148405 ATACTAGAAGCCAGAAAAATAGG - Intronic
956187421 3:66575971-66575993 ATTCTGGAAGTCAGGCAAATAGG - Intergenic
956594054 3:70947323-70947345 GTGCTATAATTGAAGAAAATGGG + Intergenic
956862700 3:73340167-73340189 ATTTTAGAAATAAGGAAAATGGG - Intergenic
956916306 3:73875464-73875486 AAGATAGAATTAAGAAAAATGGG - Intergenic
957372505 3:79313689-79313711 TTGTCAGAATTCAGCAAAATAGG - Intronic
957403923 3:79752714-79752736 AGGCTATAATTATGGAAAATAGG + Intronic
957479397 3:80771823-80771845 ATTTTAGAGTTCAGGAAAACTGG - Intergenic
958582191 3:96041067-96041089 CAGCTTGAATTCAGGAAAAGTGG - Intergenic
959440596 3:106370082-106370104 ATGCTAGAATCTATTAAAATTGG + Intergenic
960287299 3:115844116-115844138 ATGCTATAAATCATTAAAATAGG - Intronic
960733489 3:120751839-120751861 ATGGTTGAATTCAGGAGTATAGG + Intronic
962597536 3:136961767-136961789 ATGTTAGCATTCAGGGAAGTTGG + Intronic
962758038 3:138482897-138482919 GTGATAAAAGTCAGGAAAATAGG + Intergenic
963754017 3:149214425-149214447 TTTATACAATTCAGGAAAATTGG - Intronic
964178233 3:153851869-153851891 TTGTTAGAATTTAGTAAAATAGG - Intergenic
964953951 3:162328696-162328718 TTGAAAGAATTCAGGAAGATTGG + Intergenic
965295779 3:166943881-166943903 AGGCTATCATTCAAGAAAATTGG + Intergenic
965832238 3:172805383-172805405 CTCCTAGAATTCAGGAGAAGAGG - Intronic
966076274 3:175939065-175939087 ATCACAGAATTCAGAAAAATTGG + Intergenic
966571901 3:181453390-181453412 ATGCTAGGATACAAGGAAATAGG - Intergenic
970090051 4:12396012-12396034 ATAAAAGAATTGAGGAAAATAGG + Intergenic
970245120 4:14053307-14053329 ATGTGAGTATTCAGGCAAATTGG + Intergenic
970904072 4:21194774-21194796 ATGCTATCATTCAGGAACCTGGG - Intronic
971248410 4:24950933-24950955 ATGCTAGATTTGAGGAACACAGG - Intronic
971486836 4:27169252-27169274 TTGATAGAAGTCAGAAAAATAGG - Intergenic
971629208 4:28967813-28967835 ATCTTAGAATTGAAGAAAATAGG + Intergenic
971990689 4:33889222-33889244 ATGATAGAATTCTGTAAATTTGG - Intergenic
974173570 4:58295796-58295818 GTGCTAAATTTCATGAAAATGGG - Intergenic
974379508 4:61120322-61120344 AGGCTAGAAATCAGAAAAAAAGG - Intergenic
974811644 4:66953705-66953727 ATGCAAGAAGGCAGGAAATTTGG + Intergenic
975815291 4:78210682-78210704 ATGATACAATTATGGAAAATAGG + Intronic
975817845 4:78237778-78237800 ATGTTAAAATTCTGGAAAATAGG - Intronic
975875745 4:78834986-78835008 ATGCTAGAATTCAGGAAAATGGG - Intronic
975937118 4:79595474-79595496 ATCCTAGAATTCATGAAATATGG + Intergenic
976219679 4:82746238-82746260 ATACCAGATTGCAGGAAAATGGG + Intronic
976408365 4:84684799-84684821 CTGGTAGAATTTAAGAAAATAGG - Intronic
976459844 4:85297266-85297288 TTGTTAGAAGTCAGGAAAAGTGG + Intergenic
979881330 4:125963544-125963566 TTGCTAAAATTCAAGAAAATAGG + Intergenic
980971257 4:139569209-139569231 AGGCTTGATTTCAGGATAATGGG - Intronic
982372710 4:154651437-154651459 ATGCAAAAAAGCAGGAAAATAGG - Intronic
982549857 4:156784210-156784232 AGGATAGAAGACAGGAAAATGGG + Intronic
982796861 4:159656676-159656698 ATGTTAAAATGAAGGAAAATTGG - Intergenic
984442734 4:179792957-179792979 ATACTATATTTTAGGAAAATTGG + Intergenic
985177554 4:187217578-187217600 ATGTTACTATTGAGGAAAATTGG + Intergenic
986498567 5:8373151-8373173 ATGCTAGGATGCAGTGAAATTGG + Intergenic
986559079 5:9042517-9042539 ATGTTGTAATTCAAGAAAATAGG - Exonic
991641152 5:68754636-68754658 ATGCTGGAAGCCATGAAAATAGG - Intergenic
992343371 5:75849297-75849319 ATGCTAAGCTTCAGGAAAGTAGG + Intergenic
992939267 5:81747321-81747343 ATGCTAGAAAACAGGAAAGCTGG - Intronic
993520879 5:88898482-88898504 AGCCTAGACTCCAGGAAAATAGG + Intronic
993562274 5:89424850-89424872 ATGCTAAAGTTCAGGCAAGTGGG - Intergenic
993748181 5:91628696-91628718 GTCCTAGGATTCAGGAAAAGAGG + Intergenic
993816288 5:92550309-92550331 ATCCTAGTAGTTAGGAAAATTGG + Intergenic
993930217 5:93929270-93929292 AGGCTATAATTCAGGAAACTGGG - Intronic
994559165 5:101346061-101346083 ATGCTGGAATTCAGGAATCACGG + Intergenic
995280558 5:110330985-110331007 ATACTAGAAGTCAGGAATCTTGG - Intronic
996452768 5:123645489-123645511 TTGCTAGAAAACAGCAAAATTGG + Intergenic
996743116 5:126820326-126820348 ATGCAAGAAGTCTGGTAAATGGG - Intronic
999080713 5:148840902-148840924 ATGCTAACATTCAGGGAAACAGG + Intergenic
1003291194 6:4779658-4779680 CTGCTAGGATTGAGGAAAAACGG + Intronic
1003487445 6:6591866-6591888 ATGCGTGAAGGCAGGAAAATGGG + Intronic
1005196074 6:23285854-23285876 TTGCAAGAATTCAGGAACACCGG + Intergenic
1005858090 6:29879355-29879377 CTGCTATAATTCAAAAAAATTGG - Intergenic
1006827919 6:36949631-36949653 TCGGAAGAATTCAGGAAAATGGG - Intronic
1007567957 6:42867397-42867419 ATGTTACAATACAGGAAAAAGGG - Exonic
1008326771 6:50191801-50191823 AGGCTAGAAATCAGGAAAGTGGG - Intergenic
1008473377 6:51909414-51909436 ATGCTAGGATCCAGGGATATGGG - Exonic
1009866278 6:69401633-69401655 ATGCTAGACTGCAGGTAAAGTGG - Intergenic
1011639380 6:89404823-89404845 AAACCAGAAATCAGGAAAATGGG + Intronic
1011725288 6:90204816-90204838 CTGCTAGAATACTGGAAAGTAGG - Intronic
1011936165 6:92780743-92780765 ATGGAAGAATTCAAAAAAATTGG + Intergenic
1012811486 6:103965331-103965353 ATGAGAGAATTCAAGAAAGTAGG + Intergenic
1013738587 6:113257105-113257127 ATGTTAGAAATCAGGACAGTGGG + Intergenic
1013865963 6:114696593-114696615 GTGCTAGAAATCAGGAGGATTGG + Intergenic
1015043322 6:128747567-128747589 ATTCAAGAATTTAGAAAAATGGG + Intergenic
1016129695 6:140452018-140452040 ATGATAAAAACCAGGAAAATAGG - Intergenic
1018571444 6:165215271-165215293 ATGATAAAAGTCAGGAAATTAGG - Intergenic
1019059324 6:169243962-169243984 ATGTCAGACTTAAGGAAAATTGG - Intronic
1019391949 7:793377-793399 AAAATAGAATTCTGGAAAATGGG - Intergenic
1020610341 7:10388483-10388505 CTGTTAGAATTCAGGGCAATGGG + Intergenic
1020816139 7:12908403-12908425 ATTCTAAACTTCAGGAAAACTGG - Intergenic
1021291821 7:18854811-18854833 ATGCTAAAATTTATGAAAATGGG + Intronic
1021301515 7:18979293-18979315 ATCTTAAGATTCAGGAAAATGGG - Intronic
1022020065 7:26390482-26390504 CTGCTAGGATTCATAAAAATTGG - Intergenic
1022161588 7:27716076-27716098 ATCCTAAAACTGAGGAAAATAGG - Intergenic
1022196753 7:28075485-28075507 ATGGTAAAAATCAGGAAAAGTGG - Intronic
1022587944 7:31633583-31633605 CAGCTAGACTTCAGGACAATGGG - Intronic
1022979040 7:35586089-35586111 ATTTGAGAAATCAGGAAAATTGG + Intergenic
1022999663 7:35795157-35795179 AGGATAGGATTCAGGACAATAGG + Intergenic
1024359165 7:48449749-48449771 ATGCTGGATTTCAGAATAATTGG - Intronic
1024681465 7:51693695-51693717 ATCCAAGAAGTAAGGAAAATGGG - Intergenic
1026289402 7:68992564-68992586 ATTCTAGAATTCATTAAAATAGG + Intergenic
1028679410 7:93508015-93508037 ATTCTAGGTTTCAGGAAATTGGG - Intronic
1029245615 7:99198360-99198382 ATGCAAAAATTCAACAAAATAGG + Intronic
1030402004 7:109063523-109063545 ATGCTAGTTGACAGGAAAATGGG - Intergenic
1030439302 7:109566434-109566456 ATGGTAGAGTTGAGGACAATAGG + Intergenic
1031707746 7:125002932-125002954 ATTCTAGAAGGCAGAAAAATTGG - Intergenic
1031739208 7:125407649-125407671 ATGCTAGATTACAGGACAATGGG + Intergenic
1032893101 7:136220931-136220953 ATGCTAAAATTTAAAAAAATTGG + Intergenic
1032932032 7:136683729-136683751 ATGCTAGGTTGCAGGAAAACAGG + Intergenic
1037202534 8:16275698-16275720 ATGCTGAAAATCAAGAAAATTGG + Intronic
1037611423 8:20479162-20479184 AGTCGAGAAGTCAGGAAAATGGG + Intergenic
1038898630 8:31816357-31816379 ATGCTGGAATTCAGGTGACTTGG - Intronic
1040674965 8:49737699-49737721 ATGTGACAATTCAGAAAAATTGG - Intergenic
1043481434 8:80656644-80656666 ATGCTAGATTTCCTGAACATTGG - Intronic
1044055351 8:87562942-87562964 ATGCTATCATTGAGGAAAACGGG - Intronic
1044459747 8:92430046-92430068 AAGCTAGGAATCAGGAAAATAGG - Intergenic
1045195008 8:99921887-99921909 ATCCTAGAACTAAGGAAAACTGG - Intergenic
1045998897 8:108396059-108396081 ATGCTACAACTCTAGAAAATGGG + Intronic
1046705089 8:117440789-117440811 ATTTTAGAATTCAGGGAAAATGG - Intergenic
1051089017 9:13384920-13384942 ATGTTAATATTCAAGAAAATGGG + Intergenic
1055606770 9:77978435-77978457 AGGCTAGAAGGCAGGAAAAGAGG - Intronic
1056067478 9:82951935-82951957 ATGCTATAATTAAGGAAATGTGG - Intergenic
1056079373 9:83074945-83074967 ATGGTAGAATGCAGGAAGACTGG + Intergenic
1057224400 9:93282126-93282148 ATGTTAAAATGCATGAAAATGGG + Intronic
1058336187 9:103832386-103832408 ATACTAGTGTTCAGGAAAAAAGG + Intergenic
1059935946 9:119310760-119310782 ATGCTAGCATACAGGAAGACAGG + Intronic
1060319634 9:122544947-122544969 ATGCTTGAATTAAGGAAAAAAGG - Intergenic
1060760305 9:126241628-126241650 ATGGTAGAAATAAGGAAGATAGG - Intergenic
1061110201 9:128563969-128563991 ATGCTAGAAATCAGGGATACAGG + Intronic
1185728192 X:2439959-2439981 ATGCTAAAATTCATTAAAATGGG + Intronic
1186952955 X:14647569-14647591 ATGCTACAAGTCAGGAGAATGGG + Intronic
1187316423 X:18199534-18199556 ATGTTATCATTGAGGAAAATGGG + Intronic
1187922313 X:24216972-24216994 AGGCTAGAACACAGGAAAAGGGG + Intergenic
1189029552 X:37436730-37436752 ATGAGAGAATTCAGGAAAGAAGG + Intronic
1189846382 X:45142497-45142519 AGGCAAAAATTCAGGAAAAGAGG - Intergenic
1190008762 X:46764403-46764425 ATGATAGCTTTCAGCAAAATAGG + Intergenic
1190909253 X:54757099-54757121 ATGCTAGAAGGCAGCAAGATTGG + Exonic
1191750948 X:64542132-64542154 CTTCTAGAATACAGGAAAAGAGG + Intergenic
1191807995 X:65155884-65155906 CTTCTAGAATACAGGAAAAGTGG - Intergenic
1192819833 X:74633260-74633282 ATGATAAAATTGAAGAAAATGGG - Intergenic
1194924047 X:99803306-99803328 AGGCTTGGATTCAGCAAAATAGG + Intergenic
1195452239 X:105028706-105028728 AAGCTAGAATTCAGAAATAAAGG + Intronic
1195497979 X:105560127-105560149 CTGCTAGAGTTCAGGCAAGTTGG - Intronic
1197159831 X:123310668-123310690 AGGCTAGAATTTAGAAAAAAAGG - Intronic
1197307094 X:124856126-124856148 ATTCTAGAAGGAAGGAAAATTGG - Intronic
1197318284 X:124995456-124995478 ATGCTAGGACTCAGGAAACTTGG - Intergenic
1197849360 X:130841285-130841307 ATGCCAGAATGTAGAAAAATGGG - Intronic
1200938060 Y:8755674-8755696 ATGCAAGAATCCAGTATAATGGG + Intergenic
1202075567 Y:21034825-21034847 ATGTCAGAATTCTTGAAAATGGG + Intergenic