ID: 975891904

View in Genome Browser
Species Human (GRCh38)
Location 4:79039754-79039776
Sequence CAGACTGCTTATATTGATAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975891902_975891904 7 Left 975891902 4:79039724-79039746 CCAATGGGATTAAGAAAGATGGG No data
Right 975891904 4:79039754-79039776 CAGACTGCTTATATTGATATTGG No data
975891900_975891904 14 Left 975891900 4:79039717-79039739 CCAAAATCCAATGGGATTAAGAA No data
Right 975891904 4:79039754-79039776 CAGACTGCTTATATTGATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975891904 Original CRISPR CAGACTGCTTATATTGATAT TGG Intergenic
No off target data available for this crispr