ID: 975893000

View in Genome Browser
Species Human (GRCh38)
Location 4:79051301-79051323
Sequence TACAAAACCCTGTTTCATAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975893000_975893002 29 Left 975893000 4:79051301-79051323 CCACTATGAAACAGGGTTTTGTA No data
Right 975893002 4:79051353-79051375 GTGTCACTCTTTACTAGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975893000 Original CRISPR TACAAAACCCTGTTTCATAG TGG (reversed) Intergenic
No off target data available for this crispr