ID: 975893002

View in Genome Browser
Species Human (GRCh38)
Location 4:79051353-79051375
Sequence GTGTCACTCTTTACTAGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975892999_975893002 30 Left 975892999 4:79051300-79051322 CCCACTATGAAACAGGGTTTTGT No data
Right 975893002 4:79051353-79051375 GTGTCACTCTTTACTAGAGCTGG No data
975893000_975893002 29 Left 975893000 4:79051301-79051323 CCACTATGAAACAGGGTTTTGTA No data
Right 975893002 4:79051353-79051375 GTGTCACTCTTTACTAGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975893002 Original CRISPR GTGTCACTCTTTACTAGAGC TGG Intergenic
No off target data available for this crispr