ID: 975893087

View in Genome Browser
Species Human (GRCh38)
Location 4:79052331-79052353
Sequence GTCTATAATAGACCTGGCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975893081_975893087 23 Left 975893081 4:79052285-79052307 CCATGGTGACATTTTTTCTTATA No data
Right 975893087 4:79052331-79052353 GTCTATAATAGACCTGGCCATGG No data
975893082_975893087 0 Left 975893082 4:79052308-79052330 CCAATTGCTTCTTTGCCTACCAG No data
Right 975893087 4:79052331-79052353 GTCTATAATAGACCTGGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975893087 Original CRISPR GTCTATAATAGACCTGGCCA TGG Intergenic
No off target data available for this crispr