ID: 975894992

View in Genome Browser
Species Human (GRCh38)
Location 4:79078472-79078494
Sequence TTCCCATGTTGAGGCAGTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975894990_975894992 -1 Left 975894990 4:79078450-79078472 CCGTCAGGATGTTGATAAGATGT No data
Right 975894992 4:79078472-79078494 TTCCCATGTTGAGGCAGTTCTGG No data
975894987_975894992 15 Left 975894987 4:79078434-79078456 CCATATGGTTTGCTGCCCGTCAG No data
Right 975894992 4:79078472-79078494 TTCCCATGTTGAGGCAGTTCTGG No data
975894989_975894992 0 Left 975894989 4:79078449-79078471 CCCGTCAGGATGTTGATAAGATG No data
Right 975894992 4:79078472-79078494 TTCCCATGTTGAGGCAGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975894992 Original CRISPR TTCCCATGTTGAGGCAGTTC TGG Intergenic
No off target data available for this crispr