ID: 975908340

View in Genome Browser
Species Human (GRCh38)
Location 4:79242229-79242251
Sequence GCCCACCTGCACCTTGGAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 371
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 335}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975908333_975908340 23 Left 975908333 4:79242183-79242205 CCTAGAGAGTCTTGTAAGCACTA 0: 1
1: 0
2: 1
3: 11
4: 117
Right 975908340 4:79242229-79242251 GCCCACCTGCACCTTGGAGGGGG 0: 1
1: 0
2: 1
3: 34
4: 335

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975908340 Original CRISPR GCCCACCTGCACCTTGGAGG GGG Intronic