ID: 975914287

View in Genome Browser
Species Human (GRCh38)
Location 4:79305072-79305094
Sequence AGAATTCAGCCCATGAAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 207}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975914287_975914290 21 Left 975914287 4:79305072-79305094 CCTGTCTTCATGGGCTGAATTCT 0: 1
1: 0
2: 2
3: 18
4: 207
Right 975914290 4:79305116-79305138 CTTCATGTAGAGAATGCTGCCGG 0: 1
1: 0
2: 0
3: 16
4: 165
975914287_975914289 -4 Left 975914287 4:79305072-79305094 CCTGTCTTCATGGGCTGAATTCT 0: 1
1: 0
2: 2
3: 18
4: 207
Right 975914289 4:79305091-79305113 TTCTTTCTCAGGATGTTCTTTGG 0: 1
1: 0
2: 6
3: 37
4: 409
975914287_975914291 22 Left 975914287 4:79305072-79305094 CCTGTCTTCATGGGCTGAATTCT 0: 1
1: 0
2: 2
3: 18
4: 207
Right 975914291 4:79305117-79305139 TTCATGTAGAGAATGCTGCCGGG 0: 1
1: 0
2: 0
3: 14
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975914287 Original CRISPR AGAATTCAGCCCATGAAGAC AGG (reversed) Intronic
901419067 1:9137967-9137989 AGAATTCTGCCCATCAAGGCCGG - Intergenic
901440549 1:9275426-9275448 AGCATACGGCCCAGGAAGACGGG - Intergenic
903258456 1:22118237-22118259 TGAATTCAGCCACTGAACACAGG + Exonic
903725030 1:25435225-25435247 AGAATCCAGTACATGAAGACAGG - Intronic
905378810 1:37545010-37545032 AGAAACCAGACCATGATGACTGG + Intronic
905563832 1:38947706-38947728 CGAATTCGGCACAAGAAGACTGG + Intergenic
908867646 1:68569272-68569294 GCATTTCAGCCCAAGAAGACAGG - Intergenic
909033847 1:70574285-70574307 AAAATTCAGCCCAAGGAGTCAGG - Intergenic
909138567 1:71833762-71833784 ATAATTAAGCACATGAAGAATGG - Intronic
909988393 1:82191136-82191158 AGAGTGCAGCCGATGAAGAATGG - Intergenic
911710813 1:101070585-101070607 AAAATTCTGCCAATGAAAACAGG + Intergenic
913296941 1:117331087-117331109 AGATTTTAGCCCCTGAAGCCAGG + Intergenic
913968215 1:143394250-143394272 AGAAACCAGCCCAAGAAGAAAGG + Intergenic
914062594 1:144219842-144219864 AGAAACCAGCCCAAGAAGAAAGG + Intergenic
914116556 1:144746512-144746534 AGAAACCAGCCCAAGAAGAAAGG - Intergenic
916655297 1:166870122-166870144 ACAATTCAGCCCATAGAGCCAGG - Intronic
916947440 1:169742949-169742971 AGAATTCTGCCCACCAAGGCTGG + Intronic
917454712 1:175176517-175176539 AGATTTAAGCCCATGCAGAAAGG - Intronic
918218355 1:182413403-182413425 AGATATCAGCCCATGAACAGAGG + Intergenic
919448956 1:197746982-197747004 AGAAATCAGGCCTTGAAGAGAGG - Intronic
920725355 1:208429754-208429776 TGATTTCAGCCCATGAACTCTGG + Intergenic
922008810 1:221559853-221559875 AAAGTTCATCCCATGAGGACAGG + Intergenic
923741179 1:236656533-236656555 CGAATTCATCCCATGCAGACTGG - Intergenic
1065379811 10:25078466-25078488 AGAATTCATCACATGATGTCAGG + Intergenic
1065620362 10:27574854-27574876 ACGACTCAGCCCCTGAAGACTGG - Intergenic
1065984304 10:30934172-30934194 AGAAATCAGCACTTGAGGACTGG + Intronic
1068758400 10:60680779-60680801 AGAATTCAAACCAGGCAGACTGG - Intronic
1069408871 10:68131672-68131694 AGAATACCGCCTATGAAGGCTGG - Intronic
1070951168 10:80432142-80432164 ACAATACATCCCATGAACACAGG - Exonic
1071307522 10:84312328-84312350 ACAATTCAGCCCATAATGGCAGG - Intergenic
1071714034 10:88077084-88077106 AGAAATCAGCCCATGACCCCAGG - Intergenic
1073852944 10:107642405-107642427 AGAAGTCAGCTCATGATGAGTGG + Intergenic
1074477825 10:113788668-113788690 AGAACTCAGACCAGAAAGACTGG + Intergenic
1074529419 10:114287026-114287048 AGAATGCATCCCAAGTAGACAGG - Intronic
1076253371 10:129000341-129000363 AGAATTCAACCCATGAAGTCAGG - Intergenic
1080133648 11:28827302-28827324 TGAAACCAGTCCATGAAGACTGG - Intergenic
1083199112 11:61109064-61109086 AGAATTCAGCCCAGGGCGGCTGG - Intronic
1084429399 11:69102844-69102866 AGAAGTCACCCAGTGAAGACAGG + Intergenic
1084569288 11:69949785-69949807 ACCATTCAGCCCATGGAGCCAGG + Intergenic
1087840434 11:102915116-102915138 CAAAGTCAGCCCATAAAGACTGG + Intergenic
1088747892 11:112819826-112819848 AGAACTCAGCCCTTGAAGTGGGG - Intergenic
1089408654 11:118220133-118220155 TAAATTCTCCCCATGAAGACAGG + Intronic
1092989317 12:13879818-13879840 AGAATTCTGCCCATGGATTCTGG - Intronic
1093647326 12:21601985-21602007 AGAATTTTGCCCATGAACAATGG - Intronic
1098161771 12:67652543-67652565 AGAATTGAGTCCAAAAAGACTGG - Intronic
1099904031 12:88750852-88750874 AGAATTCAGCACAGGGTGACTGG + Intergenic
1099996969 12:89788461-89788483 AGAATTAAGCCCAAGACTACAGG - Intergenic
1100143493 12:91648421-91648443 AGAAAGCAGCACATAAAGACTGG + Intergenic
1104010957 12:124929626-124929648 AGAATTCAGCCCATGACACCAGG - Intergenic
1104982735 12:132581528-132581550 TGAATTCAGCCCACGCAGCCTGG + Intronic
1106229152 13:27808403-27808425 AGAATTCAGCCCATAACAATAGG - Intergenic
1106410859 13:29510728-29510750 AGAACCCACACCATGAAGACAGG - Exonic
1107230437 13:38103849-38103871 AGAGACCAGACCATGAAGACTGG + Intergenic
1109371403 13:61424861-61424883 AGTATTCAGCCAATGGAGATGGG + Intronic
1109551848 13:63914411-63914433 AGAATTTAGCCCCTGAGGGCTGG - Intergenic
1109725635 13:66337557-66337579 AGTTTGCATCCCATGAAGACAGG - Intronic
1110336948 13:74344344-74344366 AGATTTCAGAACTTGAAGACGGG - Intergenic
1111232886 13:85366892-85366914 AGAATTCAGAACATGATGGCTGG + Intergenic
1111247500 13:85559603-85559625 AGAATAAAGACCATGTAGACAGG - Intergenic
1112412948 13:99179554-99179576 AGTTTCCAGCCCATGAATACGGG - Intergenic
1112584822 13:100708942-100708964 ACAATTCAGCCCATAACAACTGG + Intergenic
1113711190 13:112466611-112466633 AGACTTCACCCCAGGAACACCGG + Intergenic
1118902272 14:69996455-69996477 AGAATACAGCCCAAGAAGACAGG - Intronic
1119446279 14:74666553-74666575 AGAATGTAGCCCATGAGGGCTGG + Intronic
1119898914 14:78243601-78243623 AGAATTAACCCCTTGAAGCCGGG - Intronic
1120072757 14:80122378-80122400 TGAATTCTTCCCATGAAAACAGG - Intergenic
1120447927 14:84624829-84624851 ATAATTCAGCTCATGAGGAATGG + Intergenic
1122455285 14:101845503-101845525 TGCTTTCCGCCCATGAAGACTGG - Intronic
1123936276 15:25195652-25195674 GTAATTCAGCCCATGAGGTCAGG + Intergenic
1125144002 15:36444760-36444782 AAAATTCAGCCCATGTAGAAAGG - Intergenic
1125704691 15:41723340-41723362 AGAATTGAAGCCATGAAAACAGG - Intronic
1126419636 15:48457738-48457760 ATAATTCAGCCAATAAATACAGG - Intronic
1129172215 15:73815116-73815138 GGAATACAGCCCAGGAAGAGGGG + Intergenic
1131108260 15:89749132-89749154 TGAATCCAGCCAATGCAGACAGG + Exonic
1131348258 15:91671737-91671759 ACAATTCAACCCATAAAAACAGG + Intergenic
1133322981 16:4925748-4925770 AGATTCGAACCCATGAAGACGGG + Intronic
1133577785 16:7110455-7110477 AGACTTCAGCCAATTAACACAGG + Intronic
1133692390 16:8229351-8229373 AAAGTTCAGCCCATGAGAACGGG - Intergenic
1134124941 16:11610123-11610145 ATAATCCAGCCCAGGAGGACTGG + Intronic
1135398228 16:22147399-22147421 AGCATCAAGCCCAAGAAGACAGG + Intronic
1135664437 16:24324268-24324290 AGAATTCAGCCCACAAACCCAGG + Intronic
1136016398 16:27403724-27403746 AGCTTTGAGCCCATGGAGACGGG + Intronic
1140858228 16:78996713-78996735 AGTAAACAGCCCATGAAAACAGG + Intronic
1141223712 16:82095161-82095183 AGGTGTCAGCCCACGAAGACAGG + Intronic
1145785030 17:27588081-27588103 AGAATTGAGCCCCTGCACACTGG + Intronic
1150627391 17:66850144-66850166 AGAATGCAGGGCAGGAAGACAGG - Intronic
1151320498 17:73349648-73349670 TGAAAGCAGCCCATGAGGACAGG - Intronic
1151751566 17:76041573-76041595 ACAATTCAGCACATGAAATCAGG + Intronic
1154302647 18:13207812-13207834 AGAATACAGCACATGAAAAATGG + Intergenic
1155886860 18:31218507-31218529 AAACTTCAGAGCATGAAGACAGG + Intergenic
1156449744 18:37260180-37260202 AGAATTCACTCTATGGAGACAGG - Intronic
1160055620 18:75477084-75477106 AGAAAGCAGCCCAAGAAGACAGG - Intergenic
1160280648 18:77486793-77486815 AGTATTCCGCACATGAAGATGGG + Intergenic
1162082187 19:8224868-8224890 AGAATTTTGTCCCTGAAGACTGG + Intronic
1163404681 19:17114724-17114746 AGAAGTCACCCCAGGAGGACAGG - Intronic
1165450873 19:35881770-35881792 AGAATTCAATCCAAGAAGCCTGG + Intergenic
1166207338 19:41279769-41279791 AGAATTCAGGCCATACAGAAAGG + Intronic
1202702002 1_KI270712v1_random:171714-171736 AGAAACCAGCCCAAGAAGAAAGG + Intergenic
926359466 2:12072182-12072204 GGATTTGAACCCATGAAGACTGG + Intergenic
927217789 2:20678593-20678615 AGAATTCTGCACATGACGAGTGG + Intergenic
927876726 2:26661602-26661624 ATAATTCAGCCCACAATGACAGG - Intergenic
927894342 2:26771826-26771848 AGACTCCAGCCCATGAGGTCAGG + Intronic
928337337 2:30408895-30408917 AGAATCCAGCCTAGGAAGAAAGG - Intergenic
928992904 2:37254536-37254558 AGACTTCAGCCCAGGCAGTCAGG - Intronic
933648443 2:84830701-84830723 TGAATACAGGGCATGAAGACAGG + Intronic
934172914 2:89555164-89555186 AGAAACCAGCCCAAGAAGAAAGG + Intergenic
934283228 2:91629521-91629543 AGAAACCAGCCCAAGAAGAAAGG + Intergenic
938319580 2:130354182-130354204 AGACCTCAGCCTATGAGGACAGG + Intergenic
938595794 2:132785949-132785971 GGGATTCCTCCCATGAAGACAGG - Intronic
938668639 2:133565705-133565727 AGACTTCTGACCATGAAGACGGG - Intronic
941610928 2:167661392-167661414 AGAAATCAGCCTCTAAAGACTGG - Intergenic
942430692 2:175907976-175907998 AGATTTCAGCTCAGGAAGTCTGG - Intergenic
943107414 2:183562959-183562981 AAAATGCAGCATATGAAGACAGG + Intergenic
943299550 2:186180677-186180699 AAAATTCAACCCATAAACACAGG + Intergenic
943557388 2:189422047-189422069 CAAATTCAGTCTATGAAGACTGG + Intergenic
944486353 2:200210513-200210535 AGAATACAGCCAAGGTAGACTGG + Intergenic
945126510 2:206517204-206517226 GGCAGTCAGCCCATGAAGACTGG - Intronic
946700777 2:222411092-222411114 AAAATCCAGCCCATGGAGACTGG - Intergenic
1169886108 20:10399520-10399542 AACGTTCAGCCCATGAAGAGAGG + Intergenic
1170076986 20:12430161-12430183 AGAATTCGGCGCATGGACACCGG - Intergenic
1170472299 20:16680386-16680408 GGACTTCAGCTCATGAAGAGGGG - Intergenic
1172496027 20:35384993-35385015 AGAATTCAGCCCTGGAAACCTGG + Intronic
1174145998 20:48453098-48453120 AGATTTCAACCCAGGAAGCCTGG + Intergenic
1174767587 20:53268531-53268553 AGATGTAAGCCCAGGAAGACCGG - Intronic
1176363397 21:6017337-6017359 AGCATGCAGCTCATGGAGACAGG - Intergenic
1177762929 21:25422295-25422317 ACGTTTCATCCCATGAAGACAGG + Intergenic
1177839838 21:26223271-26223293 AGAATTCTGCCCATATGGACTGG + Intergenic
1178966041 21:37119312-37119334 AGAATTCACCCCATGAATTATGG + Intronic
1179760121 21:43521208-43521230 AGCATGCAGCTCATGGAGACAGG + Intergenic
1180022464 21:45137118-45137140 TGAATCCAGACCTTGAAGACTGG + Intronic
1180258940 21:46653288-46653310 ATAAGTCAGCTCATGAAAACAGG + Intronic
1182086062 22:27562061-27562083 AGAATTCTGCCCCTGAAGTAGGG + Intergenic
1184024041 22:41840744-41840766 GGAATTCAGAACATAAAGACAGG - Intronic
1185076229 22:48684332-48684354 AGAATTGAGCCCAGGAGGAGAGG + Intronic
950545189 3:13634153-13634175 AAAATTCAGCCCCGGAAGAGAGG - Intronic
954489845 3:50893126-50893148 TGAAGTCAGTCCATAAAGACCGG + Intronic
955204799 3:56886204-56886226 AGACATAAGCCCATGAAGGCAGG + Intronic
955357876 3:58246526-58246548 AGAATTCAGCCCAGCCAGGCTGG - Intronic
955738117 3:62061227-62061249 AGAAGTCTGCCCAGGAAGTCTGG - Intronic
957713071 3:83889246-83889268 AGAATACAGACCATGAAGATGGG - Intergenic
958010393 3:87870931-87870953 TGAAACCAGTCCATGAAGACTGG + Intergenic
960943464 3:122949814-122949836 TGAACTCAGCACAAGAAGACAGG + Intronic
962103320 3:132365399-132365421 AGCATTCAGGCCATGATAACAGG + Intronic
962415076 3:135174445-135174467 AGGATTCTGACCCTGAAGACTGG + Intronic
964619613 3:158708221-158708243 AGTTTTCAGTCAATGAAGACAGG - Intronic
964638780 3:158886070-158886092 AGAATGCAGCATATGAAGTCAGG + Intergenic
965000088 3:162942215-162942237 AGAAGGCATCCCATGGAGACAGG - Intergenic
965347073 3:167564589-167564611 AGACTTCAGCTGATGAGGACGGG + Intronic
966071109 3:175879263-175879285 AGACTTCTGGCAATGAAGACAGG + Intergenic
966087112 3:176081147-176081169 ATAATTGAGCACATGAAGCCAGG - Intergenic
967534894 3:190590748-190590770 AGAATCAAACCCAGGAAGACTGG - Intronic
972504532 4:39707814-39707836 AGAACTCAGCTCAAGAAGGCTGG - Intronic
973082176 4:46006917-46006939 AAAATTCAGCTCAAGAAGTCAGG - Intergenic
973828457 4:54733915-54733937 AGAAATGGGCCCAGGAAGACAGG - Intronic
975914287 4:79305072-79305094 AGAATTCAGCCCATGAAGACAGG - Intronic
976909708 4:90286852-90286874 AGAAATCAAGTCATGAAGACAGG - Intronic
981284996 4:143006029-143006051 AAAAGCCAGCCCATGAAGTCTGG + Intergenic
981763186 4:148216495-148216517 AGATTTGAGCCCAAGCAGACAGG + Intronic
981773302 4:148335177-148335199 ATAATTCAGCCCATAACAACTGG + Intronic
982502730 4:156177955-156177977 AGAATTCATCCCATAAAGATAGG - Intergenic
983090477 4:163496102-163496124 AGAAATGAGCCAATGAAAACAGG - Intronic
984107559 4:175568582-175568604 AGAAATCAGCAGATGAAGATTGG + Intergenic
987539542 5:19236385-19236407 AGACTACAGCCCATGTAGAGTGG + Intergenic
988316379 5:29634977-29634999 AGACTTCAGCTGAGGAAGACTGG - Intergenic
990075014 5:51833286-51833308 AGAGTTCTGCTCATGATGACAGG - Intergenic
990305092 5:54486586-54486608 AGAATTCAGCTCATCATCACTGG + Intergenic
990660975 5:58014704-58014726 AGATTTCAGCTCAGGAATACTGG - Intergenic
992694893 5:79276512-79276534 AGAATTGAGCCCAGGAGGACGGG - Intronic
994398814 5:99253141-99253163 GGAATTCAGACCATGAATGCAGG - Intergenic
994825307 5:104706145-104706167 AGAAATCAGCAGATGCAGACTGG + Intergenic
995811596 5:116113535-116113557 AGATTTCAGAACATGAAGACAGG - Intronic
996019127 5:118572916-118572938 GGAATTCAGCCACTGTAGACTGG - Intergenic
997035870 5:130190504-130190526 AGAATTAAGCCTATAAAGATGGG - Intergenic
1000892165 5:166813102-166813124 GGAAATCAGCACCTGAAGACAGG - Intergenic
1003758077 6:9144922-9144944 AGAATTCATCACCAGAAGACTGG + Intergenic
1006429584 6:33987606-33987628 AGAACTGAGCCCCTGAAGGCAGG + Intergenic
1006430966 6:33995408-33995430 AGAATTCAACCCAGGCAGCCTGG - Intergenic
1007338348 6:41171588-41171610 AGAGATCTGCCAATGAAGACGGG + Intergenic
1007395864 6:41577451-41577473 AGATTTGAGCCCAGGAAGCCTGG - Intronic
1009784030 6:68307845-68307867 GCAGTGCAGCCCATGAAGACAGG + Intergenic
1011224489 6:85091924-85091946 TGAATTCAGCATATGAAGATGGG + Intergenic
1013934427 6:115576503-115576525 GGATTTCAACCCAGGAAGACTGG + Intergenic
1014339779 6:120190276-120190298 ACAACTCAACCCATGAAGAATGG + Intergenic
1016946676 6:149540988-149541010 AGAATTAAGCACAAGAAGAAAGG - Exonic
1018012688 6:159686033-159686055 AGAAAACTGCCCATCAAGACAGG - Intronic
1018108188 6:160509011-160509033 ATATTTCAGCCCATGAAAACTGG - Intergenic
1020419148 7:7980647-7980669 AGAATTAAGCACAAGAAGAAGGG + Intronic
1022652194 7:32287600-32287622 AGAATGCACTCCATAAAGACAGG + Intronic
1022689786 7:32637585-32637607 AGAAGGCAGCCCTTGAAGGCAGG + Intergenic
1022856070 7:34315832-34315854 GGAACTCTGGCCATGAAGACAGG + Intergenic
1023855071 7:44177936-44177958 AGAAATCAGCCTATGAGGGCGGG + Intronic
1028580207 7:92401922-92401944 ATAATTCAGCCTATGAACATTGG - Intergenic
1031949645 7:127878985-127879007 GGAATTCAACCAGTGAAGACTGG + Intronic
1031965340 7:128024004-128024026 AGGATTCAACACAGGAAGACTGG + Intronic
1035343728 7:158183683-158183705 AGAATTCAGCCCATGGGGGCGGG - Intronic
1037566728 8:20124410-20124432 CGATTTCAGCCCAGTAAGACTGG - Intergenic
1038067190 8:23975365-23975387 AGAATTAAGCAGATGAAAACAGG + Intergenic
1038491029 8:27971346-27971368 AGAGTTCAGCCCATCTAGAAAGG - Intronic
1038997721 8:32944540-32944562 AGAATTCAAAACCTGAAGACAGG - Intergenic
1040974544 8:53175529-53175551 AGACTACAGACAATGAAGACAGG + Intergenic
1041467403 8:58170576-58170598 AGAATTTAGACTATGAAGTCAGG - Intronic
1041682566 8:60608012-60608034 AGAAGTCAGACTATGAAGACAGG - Intronic
1044369926 8:91398488-91398510 TGAATTCAGCCTAGGAAGTCAGG - Intergenic
1044533253 8:93331948-93331970 AGAATTCAGCCCAGGTATCCTGG + Intergenic
1045143697 8:99315375-99315397 AAAATCCAGCACATGAAGATAGG - Intronic
1045442908 8:102232410-102232432 AGGATTCAACCCAGGCAGACAGG - Intronic
1047021731 8:120782334-120782356 ACAATTCAACCCATGAAACCAGG + Intronic
1047197777 8:122737091-122737113 AGAATTAAGCCCATGCACAAAGG + Intergenic
1049487233 8:142872755-142872777 AGATTTCAGCCTATGAATTCTGG - Intronic
1050003170 9:1099982-1100004 AGAGTACAGGCCTTGAAGACAGG - Intergenic
1052025409 9:23568509-23568531 TGGTTTCAGCCCAAGAAGACAGG + Intergenic
1055989886 9:82094184-82094206 AGAATGGAGCTCATGGAGACAGG + Intergenic
1056559100 9:87714746-87714768 GAAATTCAGCCCATAAAGCCAGG - Intergenic
1056815889 9:89800441-89800463 AGAATTCAGCCCAGGATTGCAGG - Intergenic
1057141710 9:92730362-92730384 AGAATTCAGTCCAAGAAAATAGG + Intronic
1059094258 9:111395605-111395627 AGAGTTCAGAGGATGAAGACTGG + Intronic
1060022217 9:120141448-120141470 AGATTTCATTCCATAAAGACAGG - Intergenic
1060940092 9:127538198-127538220 AGGATGCAGCCCTTGGAGACAGG - Intronic
1187411178 X:19051702-19051724 AGAACTCAGGCCATGTAGAGAGG + Intronic
1189532285 X:41898188-41898210 AAAATACAGCCTATCAAGACTGG - Intronic
1190966569 X:55306763-55306785 AGAATTCAGAGCCTGAAGACTGG - Intergenic
1192767565 X:74157821-74157843 AGAATTCATCACAACAAGACTGG + Intergenic
1193443388 X:81569354-81569376 AGAATTCTGAACTTGAAGACTGG + Intergenic
1194548408 X:95267821-95267843 ATAATTGAGCCCATTAAGCCAGG + Intergenic
1196228217 X:113190206-113190228 ACAACTCAACCCATGAAGAATGG - Intergenic
1197322827 X:125053885-125053907 AGATTTCAGCCCAAGCAGTCTGG + Intergenic
1198262201 X:134974725-134974747 AGAGTGCAGCCCATGAGGAGTGG - Intergenic
1198650648 X:138860418-138860440 AGAATCCAGCCCATTAAGATAGG + Intronic